Biology Reference
In-Depth Information
β
-D-Galactosidase Gene Amplification and Cloning to Bacterial Expression
System
Based on the known β-D-galactosidase gene sequence of
Arthrobacter
sp. 32c
(GenBank Accession No. FJ609657), the specific primers for PCR amplification
were designed and synthesized. The gene was amplified using two separate reac-
tions. The first DNA fragment was amplified using the forward primer: F1Nc-β-gal
CATGGGCAAGCGTTTTCCAAG, and reverse primer: R32c-β-gal CCCCGTC-
GACTTTTCTAGATCAGTCCTCCGCGATCAC (containing
Sal
I and
Xba
I recogni-
tion sites, underlined). The second DNA fragment was amplified using the forward
primer: F2Nc-β-gal GGCAAGCGTTTTCCAAGCGG, and reverse primer: R32c-
β-gal CCCCGTCGACTTTTCTAGATCAGTCCTCCGCGATCAC (containing
Sal
I
recognition site, underlined). The start and stop codons are given in bold. For the
NcoI sticky end generation the second forward F2Nc-β-gal primer contains only one
nucleotide of the start codon. Each PCR reaction mixture contained: 0.2 μM of each
primer, 0.2 μg of pBADmycHisALibB32c DNA, 250 μM of each dNTP, 1 U of DNA
polymerase (
Hypernova
, DNA-Gdańsk, Poland) in 1 × PCR buffer (20 mM Tris-HCl
pH 8.8, 10 mM KCl, 3.4 mM MgCl2, 0.15% Triton X-100). The reaction mixtures
were incubated for 3 min at 95°C, followed by 5 cycles at 95°C for 1 min, 50°C for 1
min, 72°C for 2 min and 25 cycles at 95°C for 1 min, 60°C for 1 min, 72°C for 2 min,
and a final incubation for 5 min at 72°C using a Mastercycler Gradient (Eppendorf,
Germany). Both amplification reaction products were purified and mixed together at
ratio 1:1. This mixture was denaturated at 95°C for 3 min and cooled down to room
temperature at 0.2°C/s. Afterwards DNA were purified by ethanol precipitation, di-
gested with
Sal
I endonuclease and cloned into pBAD/Myc/HisA (Invitrogen) vec-
tor pre-cutted with NcoI and
Sal
I endonucleases. The resulting recombinant plasmid
pBAD/Myc/HisA-β-gal32c containing the
Arthrobacter
sp. 32c β-D-galactosidase
gene under control of the pBAD promoter was used to transform chemically compe-
tent
E. coli
LMG194 plysN cells [29].
Expression of the Recombinant
-D-galactosidase Gene in
E.
coli
The recombinant plasmid pBAD/Myc/HisA-32cβ-gal was used for the expression of
the putative β-D-galactosidase gene in
E. coli
LMG 194 plysN under the control of
pBAD promoter. The cells were grown overnight at 37°C in LB medium containing
chloramphenicol (34 μg/ml) and ampicillin (100 μg/ml) in air shaker at 220 rpm. The
preculture was inoculated (1%) into fresh 1 l of LB medium containing the same anti-
biotics and cultivation was continued at 37°C to OD600 of 0.5. The culture was then
supplemented with 0.02% (w/w) arabinose (final concentrations) and grown for 4 hr
at 37°C to achieve the overexpression of β-D-galactosidase gene.
β
Pichia Pastoris Expression Plasmids Construction
The primers used for amplification of the
Arthrobacte
r sp. 32c β-D-galactosidase gene
were: F32c-β-gal ATGGGCAAGCGTTTTCCAAGCGGC and R32c-β-gal CCCC-
GTCGAC TTTTCTAGATCAGTCCTCCGCGATCAC (containing
Sal
I and
Xba
I rec-
ognition sites, underlined) (reaction A). The start and stop codons are given in bold.
The second PCR reaction was performed to obtain a linear form of DNA vectors using
