Biology Reference
In-Depth Information
primers: Phos-alfa-factor phos-TCTTTTCTCGAGAGATACCCCTTCTTCTTTAG-
CAGCAATGC and AOX1-res-insert-ATTTGAATTCTCTAGACTTAAGCTTGTTT-
GTAGCCTTAGACATGACTGTT CCTCAGTTCAAGTTG and pPICZαA (reaction
B) or pGAPZαB (reaction C) plasmid DNA as DNA template. Each PCR reaction
mixture contained: 0.2 μM of each primer, 0.2 μg of recombinant plasmid, 250 μM
of each dNTP, 1 U of DNA polymerase (Hypernova, DNA-Gdańsk, Poland) in 1 ×
PCR buffer (20 mM Tris-HCl pH 8.8, 10 mM KCl, 3.4 mM MgCl2, 0.15% Triton
X-100). Reaction A was performed using following conditions: 95°C-3 min, (95°C-1
min, 53°C-1 min, 72°C-2 min; 5 cycles), (95°C-1 min, 65°C-1 min, 72°C-2 min;
25 cycles), 72°C-5 min. Reaction B and C were performed at conditions: 95°C-3
min, (95°C-1.5 min, 66°C-1 min, 72°C-4 min; 5 cycles), (95°C-1.5 min, 68°C-1
min, 72°C-4 min; 25 cycles), 72°C-10 min. The PCR products were purified from
an agarose gel bands using DNA Gel-Out kit (A&A Biotechnology, Poland), digested
with XbaI endonuclase and ethanol precipitated. The DNA fragments from reaction A
and B and from reaction A and C were ligated with each other and chemically compe-
tent
E. coli
TOP10F' (Invitrogen) cells were transformed with those ligation mixtures,
spread out on LA plates containing 12.5 μg/ml zeocine (Invitrogen) and incubated at
37°C for 16 hr. Afterwards recombinant plasmids were isolated, linearized by SacI or
XmaJI endonuclease and used to transform
P. pastoris
GS115 competent cells using
Pichia EasyComp™ Transformation Kit (Invitrogen). The obtained
P. pastoris
GS115
recombinant strains harboring pGAPZαA-32cβ-gal or pPICZαA-32cβ-gal recombi-
nant plasmids were used to extracellular production of the
Arhrobacter
sp. 32c β-D-
galactosidase.
Expression of the
-D-galactosidase Gene in
Pichia pastoris
The
P. pastoris
GS115 recombinant strains harboring pGAPZαA-32cβ-gal or
pPICZαA-32cβ-gal plasmid were used to extracellular expression of the
Arhrobacter
sp. 32c β-D-galactosidase either constitutively or after methanol induction, respec-
tively. For both expression systems 900 ml of YPG medium (Yeast extract 1%, Pepton
K 2%, 2% glycerol) was inoculated with 100 ml of YPG medium cells cultures of the
P. pastoris
pGAPZαA-32cβ-gal or
P. pastoris
pPICZαA-32cβ-gal. In case of the con-
stitutive β-D-galactosidase expression the inoculated culture was grown with agitation
at 30°C for 4 days. After 2 days additional carbon source in form of glycerol was
added to final concentration of 3% v/v to the broth. In case of the methanol induced
variant, 100 ml overnight culture of the
P. pastoris
pPICZαA-32cβ-gal was centrifu-
gated at 1,500 × g for 10 min. The supernatant was discarded, cells were dissolved in
100 ml of BMMY medium (1% yeast extract, 2% peptone, 0.004% L-histidine, 100
mM potassium phosphate, pH 6.0, 1.34% YNB, 4 × 10
-5
% biotin, 0.5% methanol) and
added to 900 ml of the same medium. The cultivation was performed for 4 days, where
methanol was added to final concentration of 0.65%, 0.8%, and 1% after first, second
and third day, respectively.
β
β
-D-galactosidase Purification
After protein expression in
E. coli
host, the cells were disrupted according to protocol
described earlier with some modifications [29]. Cells were harvested by centrifuga-
