Biology Reference
In-Depth Information
MATERIALS AND METHODS
Isolation, Characterization, and Identification of the 32c Isolate
A 5 g of Antarctic soil was dissolved in 45 ml of water containing 1% of sea salt (Sigma-
Aldrich). After decantation 100 μl of the supernatant was spread out on LAS agar
plates that contained 1% lactose, 0.1% pepton K, 0.1% yeast extract, 1% of marine
salt, 1.5% agar and 20 μg/ml of X-gal. Pure cultures of microorganisms were isolated.
One of them was found to be a producer of β-D-galactosidase and also exhibited amy-
lolytic and proteolytic activities. This strain was primarily classified as 32c isolate and
used for further analyzes. The bacterium 32c was cultured in the liquid LAS medium
containing 1% lactose, 1% pepton K, 0.5% yeast extract, and 1% artificial sea salt
at 15°C for 2 days at 150 rpm in air shaker. The temperature profile of growth was
determined in the range 0-37°C, by means of stationary cultures in the LAS medium.
16S rDNA
Gene Amplification
Genomic DNA from isolate 32c was used as a template to amplify
16S rDNA
gene
using primers: 16S For 5' AGAGTTTGATCCTGGCTCAG 3' and 16S Rev 5' ACG-
GCTACCTTGTTACGACTT 3'. Reaction was performed in mixture containing: 0.2
μM of each primer, 0.2 μg of chromosomal DNA, 250 μM of each dNTP, 1 U of DNA
polymerase (Hypernova, DNA-Gdańsk, Poland) in 1 × PCR buffer (20 mM Tris-HCl
pH 8.8, 10 mM KCl, 3.4 mM MgCl
2
, 0.15% Triton X-100). The reaction mixture was
incubated for 3 min at 95°C, followed by 30 cycles at 95°C for 1 min, 55°C for 1
min, 72°C for 1.5 min, and a final incubation for 5 min at 72°C using a Mastercycler
Gradient (Eppendorf, Germany). PCR product was purified from an agarose gel band
using DNA Gel-Out kit (A&A Biotechnology, Poland), and cloned directionally into
pCR-Blunt vector (Invitrogen). The
16S rDNA
insert was sequenced using ABI 3730
xl/ABI 3700 sequencing technology (Agowa DE, Germany).
Genomic DNA Library Construction
The chromosomal DNA from 32c strain cells was isolated using a genomic DNA Prep
Kit (A&A Biotechnology, Poland) according to protocol for gram-negative bacte-
ria. The DNA was digested using the 20 U of SalI and 20 U of BglII endonucleases
(Fermentas, Lithuania) for 2 hr at 37°C in 1× buffer O+ (Fermentas), and 2- to 8-kb
fragments were purified from a 0.8% agarose gel using the DNA Gel Out kit (A&A
Biotechnology, Poland). Then DNA fragments were ligated with T4 DNA ligase (Epi-
centre, USA) for 1 hr at 16°C into pBAD/Myc/HisA vector (Invitrogen) pre-cutted
with the same restriction enzymes. The
E. coli
TOP10F' cells were transformed to
give the genomic library by incubation at 37°C on LA agar (10 g pepton K, 5 g yeast
extract, 10 g NaCl, and 15 g agar) containing 100 μg/ml ampicillin, 1 mM IPTG, and
20 μg/ml X-gal. After 12 hr incubation, plates were transferred to 20°C and incubated
further for 16 hr. Blue colonies were taken for analysis. These
E. coli
TOP10F' cells
were transformed with plasmid containing the
Arthrobacter
sp. 32c β-galactosidase
gene. Plasmid DNA was extracted from these recombinant strains. The insert of the
smallest recombinant plasmid (pBADmycHisALibB32c) was sequenced using ABI
3730 xl/ABI 3700 sequencing technology (Agowa DE, Germany).
