Biomedical Engineering Reference
In-Depth Information
Fig. 3 BioBrick BB-2 assembly prefix and suffix sequences
Reverse primer: 5′ GTTTCTTCCTGCAGCGGCCGCTACT
AGTA 3′ <18-24 bp of matching primer (reverse complement)>
The BBF RFC 12, or the BioBrick BB-2 assembly standard [ 4 ],
was proposed by Tom Knight in November 2008. The assembly
standard was made to tackle some of the problems associated with
the original BioBrick assembly standard, BBF RFC 10. As explained
in Subheading 1.1.1. , the scar created when joining together two
BioBricks using Standard Assembly is TACTAGAG (TACTAG
when a protein-coding part is part number two). This corresponds
to a tyrosine residue and a translation stop signal (Fig. 2 ). Normally,
the scars are not being translated, but in the cases where the two
BioBricks that are being joined together are both protein domains;
the scar of the initial BioBrick standard will cause a potential
problem, as the ribosome will receive a stop signal after having
translated only one protein domain coded by the first BioBrick.
Another problem with the initial BioBrick standard is that the scar
consists of eight bases, which will yield an altered reading frame
when joining protein domains.
For the BioBrick BB-2 standard, the enzymes used for diges-
tion of the initial parts are almost the same as for the initial BioBrick
standard. The prefix and suffix are, however, slightly modified
compared to the initial standard (Fig. 3 ).
When joining two BB-2 parts, part 1 should be digested with
EcoRI and NheI, to create an insert, while part 2 should be
digested with EcoRI and SpeI in order to create a backbone with
an opening in front of the part. The scar created in this process will
be GCTAGT, which, when translated, corresponds to alanine and
serine. It is recommended that BioBricks following the BB-2 stan-
dard should avoid restriction sites for PvuII, XhoI, AvrII, XbaI,
and SapI inside the parts. When making BioBricks compatible
with the BB-2 standard by PCR, the following set of primers
should be used:
Forward primer: 5′ GTTTCTTCGAATTCGCGGCCGCAC
TAGA 3′ <18-24 bp of matching primer>
Reverse primer: 5′ GTTTCTTCCTGCAGCGGCCGCGC
TAGC 3′ <18-24 bp of matching primer (reverse complement)>
1.1.2 BioBrick
BB-2 Assembly
Search WWH ::




Custom Search