Biomedical Engineering Reference
In-Depth Information
Fig.
2
Assembly by BBF RFC 10. Assembling two BioBrick parts using this assembly standard involves
restriction digest of the first part with EcoRI and SpeI and of the second part with EcoRI and XbaI. The digested
fragments are then ligated, yielding a new BioBrick made up by the two initial ones. Here E, X, S and P denotes
EcoRI, XbaI, SpeI, and PstI, respectively
sequence is not recognized by any restriction enzyme. This means
that when two BioBricks are joined together, the prefix in front of
the first BioBrick is restored, and the suffix behind the second
BioBrick is unchanged, while the sequence between the fused
BioBricks, called a scar, will be TACTAG in the cases where the
second BioBrick is a protein-coding part. Otherwise the scar will
be TACTAGAG. The process of joining BioBricks together using
the BBF RFC 10 standard is illustrated in Fig.
2
. When translated,
the scar sequence corresponds to a tyrosine and a stop codon.
When joining together two BioBricks following this standard,
it is also possible to digest the first BioBrick with SpeI and PstI to
create an opening behind the first brick, and the second BioBrick
with XbaI and PstI. This will create the same scar as when digest-
ing with EcoRI, XbaI, and SpeI.
For BioBricks to be compatible with the BBF RFC 10
standards, the part themselves must not contain EcoRI, XbaI,
SpeI, PstI, or NotI restriction sites. According to the original draft
standard by Tom Knight, restriction sites for PvuII, XhoI, AvrII,
NheI, and SapI should also be avoided.
To make BBF RFC 10 compatible BioBricks by PCR, the
following primer sequences should be used:
Forward primer for protein-coding parts: 5′ GTTTCTTCG
AATTCGCGGCCGCTTCTAGAG 3′ <18-24 bp of matching
primer>
Forward primer for other parts: 5′ GTTTCTTCGAATTCG
CGGCCGCTTCTAG 3′ <18-24 bp of matching primer, begin-
ning with ATG>
