Biology Reference
In-Depth Information
McAo and cell Grafting
Male Sprague-Dawley rats (Charles River) were group housed with food and wa-
ter ad libitum. Briefly, animals were subjected to 60 minutes of unilateral MCAo
initiated under halothane anesthesia [29]. At 50 minutes into the occlusion, ani-
mals were evaluated for behavioral dysfunction (forelimb flexion and contralateral
circling behavior). Animals that did not demonstrate dysfunction were removed
from the study.
CTX0E03 cells were harvested and suspended at a concentration of ~50,000
cells/µl in HBSS-NAC (HBSS without calcium, magnesium and containing 0.5
mM N-acetyl cysteine; Sigma) and implanted 4-weeks ± 3 days after the occlu-
sion. Each grafted animal received two 4.5 µl bolus injections (approximately
225,000 cells/site with control lesioned animals receiving vehicle only) over 68
sec with 4 min rest before withdrawal. Coordinates from bregma were as fol-
lows: Site 1) AP 0.0 mm, L -3.6 mm, V -5.5 mm (from skull surface at bregma);
and Site 2) AP 0.0 mm, L +3.6 mm, V -5.5 mm (from skull surface at bregma).
Animal brains were collected at 1-week (6 grafted + 2 non-grafted controls) or
4-weeks (6 grafted + 3 non-grafted controls) post-implantation. All animals were
administered Cyclosporin A (20 mg/kg, Sandoz Pharmaceuticals) in cremaphore
L (Sigma) a day prior to grafting, the day of grafting and then three times weekly
for the remaining duration of the study. In addition, Methylprednisolone (Phar-
macia Upjohn) was administered at 20 mg/kg for the first 14 days, 10 mg/kg for
days 15-17 and 5 mg/kg for days 18-19 post-grafting.
Alu sequence Assay to detect and Quantify ctX0e03 cells
The qPCR Alu assay was carried out using the LightCycler 480 and the Probes
Master mix (Roche). Briefly, an average of 250 ng of genomic DNA was amplified
using specific primers (Forward-TGAGGCAGGCGAATCGCTTGAA, Reverse-
GACGGAGTTTCGCTCTTGTTG) and a FAM-labeled fluorogenic probe
(CGCGATCTCGGCTCACTGCAACCTCCATCG) (PrimerDesign) against a
conserved region of the human Alu-Sq sequence (Accession number U14573).
The PCR was preformed under the following conditions: 95°C for 30 seconds,
followed by 45 cycles of 95°C for 15 s, 58°C for 30 s, 72°C for 15 s. Quantifica-
tion of the human CTX0E03 DNA in rat tissue was based on a standard curve
using serial dilutions that ranged from 1 to 10000 CTX0E03 cells, calculated on
the assumption that one human cell contains 6.6 pg of gDNA [30]. The standard
curve was performed in the presence of 250 ng of rat gDNA.
Search WWH ::
Custom Search