c-MycERTAM Transgene Silencing in a Genetically Modified Human Neural Stem Cell Line Implanted into MCAo Rodent Brain - Genetic Engineering: Recent Developments in Applications - page 90

ctX0e03 c-mycer tAM transgene transcription Assay
Primers were designed to specifically detect the relative c-mycER TAM transgene
transcription level in CTX0E03 cells using the Roche Diagnostics Lightcycler
LC480 system. Using SYBR Green Master mix (Roche) and primers (Forward-
AAAGGCCCCCAAGGTAGTTA, Reverse- AAGGACAAGGCAGGGCT-
ATT), which amplified the c-myc and estrogen receptor (ER) junction, qPCR
was performed under the following conditions: 95°C for 5 s, followed by 45
cycles at 95°C for 10 s, 60°C for 20 s,72°C for 20 s, 82°C for 5 s, measuring the
fluorescence. A melt curve analysis was also performed after the assay to check the
specificity of the reaction using the following conditions: 95°C for 5 s, 65°C for
60 s (1°C increments) followed by 97°C continuous. In order to carry out abso-
lute quantification of c-mycER TAM transcription, a known concentration standard
was required to plot a standard curve. Based on the assumption that CTX0E03
cell contains one genomic copy of the c-mycER TAM transgene [19] serial dilutions
ranging from 10 to 10,000 copies of c-mycER TAM were used per reaction to pro-
duce the standard curve. The standard curve was performed in the presence of rat
cDNA.
Calculation of c-mycER TAM Transcription Level in Vivo
At 1- or 4-weeks post-implantation, the rat brains were removed, cut into 50-250
mg sections and snap frozen in liquid nitrogen. The gDNA and total RNA was
then sequentially isolated from each tissue piece using the AllPrep DNA/RNA
mini kit (Qiagen). Four tissue sections were processed per rat brain (i.e. two tis-
sue sections encompassing each injection tract). In brief, the tissue samples were
homogenised in the supplied lysis buffer according to sample weight. The lysed
sample was processed first through an AllPrep DNA spin column, to isolate the
gDNA, and subsequently through an RNeasy spin column to selectively isolate
RNA. The gDNA and total RNA samples (1 µ l/reaction) were then analyzed by
qPCR for Alu signal and qRT-PCR for c-mycERTAM, respectively. Based on the
Alu signal, the number of CTX0E03 cells present per reaction was calculated
from the standard curve. Similarly, the number of c-mycER TAM transcripts present
per reaction was interpolated from the c-mycER TAM copy number standard curve.
A calculation was then carried out to correct for the amount analyzed and the
total volume of tissue sample lysate (for example, 1 µ l from a total of 650 µ l). The
corrected figures were then expressed as the number of c-mycER TAM transcripts
present over the number of CTX0E03 cells present in each tissue section. Stan-
dard error of the mean was calculated for all tissue sections found to contain cells
(Microsoft Excel version 2003).