Oil Composition Variations - Genetics, Genomics and Breeding of Crop Plants - page 272

and the following features were revealed: 1) the end of the oleate desaturase
coding sequence; 2) a spacer sequence with no hit in the databases; 3) the
end of intron 1 of the MOD gene sequence; and 4) the exon2 MOD sequence
was interrupted at the end of the R7 primer designed on the cDNA sequence.
These sequences are included in the 18,990 bp fragment entirely sequenced
and registered as EF469194 in GENBANK (Lacombe et al. 2009).
Further primer pairs were designed in the spacer region and the repeated
MOD region to obtain a specific fragment of the Pervenets insertion (Bervillé
et al. 2004, 2005, patent applied). These specific Pervenets fragments were
verified to be specific to HOAC lines derived from the Pervenets population.
The final organization of the Pervenets mutation is displayed in Fig. 8.1.
Further studies have been developed using a set of recombinant inbred
lines (RILs) constructed from 83HR4 and RHA 345, which are two restorer
lines used to avoid the Pet1 cytoplasm and the cytoplasmic male sterility in
the progenies. Two hundred and fifty F 2 plants were produced and Lacombe
et al. (2002) recovered 174 F 6 RILs. Five seeds per F 6 family were phenotyped
on half a cotyledon (GC) to determine the oleic acid content and then sown
in the field. Only, one plant per family was retained to study the segregation
of the oleic acid content. All plants were genotyped for the following
fragments: RFLP Eco RI LO:5.85 kb, Pervenets 5.85 kb + 8 kb and Hind III
traditional (LO) 8.7 kb and Pervenets (HO) 16 kb; SSR-INRA-OD1 (LO 237
bp / Pervenets 240 bp); and one Pervenets-specific fragment, F: Fc-a_7
(caaaccaccacccactaac) and R: R-(ggttctgggtctgggtctggtt) of 902 bp. The control
was the fragment F2-(tcgctaacccgttcgttctc) R2- (caaagcccacagtgtcgtc) of 173
bp designed on the MOD cDNA.
With these markers we attributed clearly which RIL carried the Pervenets
mutation as judged by the Pervenets specific insertion fragment. Moreover,
linkage disequilibrium between the SSR-INRA-MOD1 locus and the
Pervenets insertion prevents any recombination in this region. As previously,
the oleic acid content was determined on half a cotyledon. The results from
crossing phenotypes and marker analyses, not yet published, can be
summarized as follows:

1) 125 RILs were obtained with an oleic acid content of < 50% and 35 with

oleic acid content of > 50%

2) The SSR analysis showed that the ratio of the lines carrying the 237 bp

(82 lines) versus the lines carrying the 240 bp allele (78) was in
agreement with 1:1, as expected (

2 P <0.6),
All the lines carrying the 237 bp allele were LO with an oleic acid
content < 50%.
Out of the 78 lines carrying the 240 bp allele, 35 were with oleic acid
content > 50% whereas 43 were with oleic acid content < 50%. The ratio
43/35 fits an 1:1 ratio, suggesting that one independent locus controls