Biology Reference
In-Depth Information
2
Materials
2.1 Reporter Plasmid
Construction
1. psiCHECK-2 plasmid (Promega, Madison, WI, USA).
2. Sense and antisense oligonucleotides containing the miR-122
binding site and designed to have overhangs that generate
(cut) Sfg I/ Pme I restriction sites: sense- 5
CGCAGTAGA
GCTCTAGTACAAACACCATTGTCACACTCCAGTTT 3
and antisense- 5
AAACTGGAGTGTGACAATGGTGTT
TGTACTAGAGCTCTACTGCGAT 3
. Resuspend to 100
μ
M
in ultrapure water.
3. Restriction enzymes: Sgf I and Pme I.
4. 1 % Agarose gel.
5. 1× TBE buffer: 89 mM Tris base, 89 mM boric acid, 2 mM
EDTA.
6. QIAquick Gel Extraction Kit (Qiagen, Valencia, CA, USA).
7. T4 DNA ligase (New England Biolabs, Ipswich, MA, USA).
8. NovaBlue competent Escherichia coli cells.
9. psiCHECK-2 sequencing primer: 5
GCTAAGAAGTTCCCT 3
.
2.2 General
Cell Culture
1. Dulbecco's Modifi ed Eagle's Medium (DMEM, see Note 1 ):
Add DMEM/HIGH with L -glutamine powder (11.8 g) and
sodium bicarbonate (3.26 g) to ultrapure water (880 mL).
Mix and adjust the pH to 7.4 ( see Note 2 ). Add fetal bovine
serum (100 mL) and penicillin/streptomycin (50× solution,
20 mL) and fi lter sterilize. Store at 4 °C.
2. DMEM supplemented with 500
g/mL G418: Add DMEM/
HIGH with L -glutamine powder (11.8 g), sodium bicarbonate
(3.26 g), and G418 disulfate (250 mg) to ultrapure water
(880 mL). Mix and adjust the pH to 7.4. Add fetal bovine
serum (100 mL) and penicillin/streptomycin (50× solution,
20 mL) and fi lter sterilize. Store at 4 °C.
3. TrypLE Express ( see Note 3 ): a trypsin replacement (Invitrogen,
Grand Island, NY, USA).
μ
2.3 Assessment of
the psiCHECK-miR122
Reporter System
1. White clear-bottom 96-well cell culture plates.
2. X-tremGENE siRNA transfection reagent (Roche).
3. Opti-MEM Reduced Serum Medium: Add Opti-MEM
Reduced Serum Medium powder (6.8 g; Invitrogen) and
sodium bicarbonate (1.2 g) to ultrapure water (450 mL). Mix
and adjust the pH to 7.3. Bring the volume to 500 mL with
ultrapure water and fi lter sterilize. Store at 4 °C.
4. Dual Luciferase Reporter Assay Kit (Promega): Prepare 1×
Passive Lysis Buffer, Luciferase Assay Reagent II, and Stop &
Glo Reagent according to the manufacturer's protocol.
Search WWH ::




Custom Search