Biology Reference
In-Depth Information
4
Notes
1. The miRNA assay as described here directly uses circular
ssDNA omitting the ligation of the padlock probe, as the focus
is not the specifi c quantifi cation of very low concentrations of
a specifi c miRNA amongst other miRNAs but rather the detec-
tion of the maturation process of the miRNA. Should there be
specifi city problems, it is possible to use a linear ssDNA as a
padlock probe with a miRNA-dependent ligation step before
isothermal amplifi cation [
20
,
22
,
23
].
2. Important to note is that the DNA polymerase must lack exo-
nuclease activities, specially in 3
direction, as this can lead
to false generation of the mature miRNA that is used as the
primer to initiate the BRCA. The amplifi cation signal would
then not be Dicer dependent.
3. The incubator should guarantee heating of the whole reaction
vessel (oven or incubator with heated lids) in order to avoid
condensation of the reaction mixture.
4. In principle, thermal cycling is not needed for isothermal
amplifi cation. Amplifi cation must be monitored at constant
57 °C for approximately 2 h at
′
-5
′
λ
ex
= 485 ± 20 nm and
em
= 530 ± 20 nm. Lid-heating is therefore essential.
5. The synthesis of pre-miRNAs using in vitro transcription with
T7 RNA polymerase requires a double-stranded T7 promoter
sequence [
24
]. The double strand is generated by hybridizing
a 20-nt T7 primer to the 3
λ
-end of the ssDNA template. To
avoid overrun of RNA sequences, the two 5
′
′
-terminal deoxyri-
bonucleotides can be 2
-
O
-methylated. Ideally, the fi rst nucle-
otide to be incorporated should be a GTP to ensure effi cient
transcription [
25
]. The pre-miRNA sequences can be found in
the miRBase database [
26
,
27
].
Example for
Drosophila melanogaster
let-7:
T7 primer sequence: 5
′
′
-GGTAATACGACTCACTATAG-3
′
.
let-7 ssDNA template: 5
-ACAAAGCTAGCACATTGTATAG
TATGATGTGTAATTACTACTATACAACCTAC
TACCTCCTATAGTGAGTCGTATTA-3
′
.
6. An effi cient DNAse reaction is crucial for effi cient miRNA-
triggered BRCA. If low fl uorescence increase is observed,
troubleshooting may start here.
7. It should be noted that the 5
′
-arm of the pre-miRNA always
serves as the miRNA primer and never the 3
′
-arm. The mature
miRNA is double stranded and includes the guide and the pas-
senger strand. Depending on the miRNA and the tissue it is
expressed in both or either can have a target mRNA. Therefore,
the primer can but does not always have to be equal to the
mature guide miRNA.
′
