Biomedical Engineering Reference
In-Depth Information
Liu and Lu, 2003, 2006a,b; Wang et al., 2007; Claridge et al., 2008
).
Li et al. (2009)
confirm
that the DNA cross-linked Au nanoaggregates provide a higher surface area when compared
with individual Au NPs. Thus, these DNA cross-linked Au nanoaggregates have been used
in a SERS (surface enhanced Raman scattering) application (
Graham et al., 2008
), as a con-
ductive tag (Fang et al., 2008), and as a conductive matrix (Li et al., 2008).
Li et al. (2009)
indicate that DNA cross-linked Au NP aggregates very significantly enhance the sensitivity
of biosensors.
Recently, Li et al. (2008) developed a multicomponent Au NP-based nano probe. This nano
probe includes the following functions: DNA recognition, signal amplification (HRP; horse
radish peroxidase) and blocking of nonspecific binding (NSB) by using BSA (bovine serum
albumin). The authors used a sandwich type assay (
Nam et al., 2004; Polsky et al., 2006;
Zhang et al., 2006a
). They confirm that their capture probe enabled the target DNA along
with the detection probe to come close to the magnetic particles. The complexes were further
magnetically separated for optical detection. They (
Li et al., 2009
) have recently improved on
their initial method by hybridizing their detection probe Au NP with another cross-linking
probe DNA (which they call a cross-linking nano probe, CNP). This permits them to load
higher amounts of HRP. The HRP that is on the surface of the Au aggregates catalyzes the
enzyme substrate and generates an optical signal. The generated enzymatic signal is used
as a read out for the target DNA. The authors used wild-type breast cancer-related BRCA-1
gene as the target (
Stenson et al., 2009
).
Li et al. (2009)
used the following oligonucleotides in their analysis:
Capture probe: 5
0
(biotin)-TTTTTTTTTTTTCCCACCAACGCTG-3
0
Detection probe: 5
0
ATCAATTCCACAGTTTTCGCTTTTTTTTTTTTTT-(CH
2
)6-SH
Cross-linking probe: 5
0
SH-(CH
2
)
6
-TTTTTTTTTTTTGATTATTCATAC3
0
target probe: 5
0
GAGCATACATAGGGTTTCTCTTGGTTTCTTTGATTATAAT
One-base mismatched DNA: 5
0
ACACGCTTGGTAGACTTTTTTTTTTAGCATCGAT
AACGTT
blocking DNA: 5
0
TTTTTTTTTT 3
0
Li et al. (2009)
point out that Au NPs have a high surface-to-volume ratio. This permits the
attachment of multiple kinds of biomolecules to the single nanoparticle surface (
Niemeyer,
2001; Niemeyer and Ceyhan, 2001; Katz and Willner, 2004; Hazarika et al., 2006; Hill
and Mirkin, 2006; Becker et al., 2007
). They attached HRP (horse radish peroxidase),
thiolated oligonucleotide (detection probe or cross-linking probe), and BSA to the surface
of the Au NPs in a sequential fashion. They suggest that the treatment with BSA as a nonspe-
cific blocker is essential as it minimizes the background noise. They also show that the cross-
linked Au NPs aggregates exhibit an average height thirty times that of the single Au NP
(600 nm when compared with 20 nm). This eventually leads to a higher HRP loading for
the DNA bridged Au aggregates and to a higher sensitivity for the Au NP aggregates when
