Photoluminescence of Gold Nanoparticles and Their Applications to Sensing and Cell Imaging - From Bioimaging to Biosensors: Noble Metal Nanoparticles in Biodetection - page 203

Using two differently sized Au NPs, acting separately as donor
and acceptor, homogeneous PL quenching assays have been
developed for the analysis of proteins. 31 The introduction of a breast
cancer marker protein, platelet-derived growth factor AA (PDGF
AA), to a solution of 11-MUA-protected, 2.0 nm luminescent Au NPs
provided PDGF AA-Au NPs as donors. Thiol-derived PDGF binding
DNA aptamers (Apt) and 13 nm spherical Au NPs were used for the
preparation of Apt-Au NP acceptors. Aptamers are DNA or RNA
sequences recognizing speciic target analytes; they are isolated from
random-sequence DNA or RNA libraries through in vitro selection
or systematic evolution of ligands by exponential enrichment
(SELEX). 74-76 Relative to antibodies, aptamers possess certain
advantageous features, including relatively simple and inexpensive
syntheses through automation, tolerance to internal labeling,
and long storage times without altering or losing their biological
properties. The aptamer selected for PDGF has the sequence
CAGGCTACGGCACGTAGAGCATCACCATGATCCTG; it exhibits strong
binding afinity toward PDGF ( K d ~ nM). 77 The consensus secondary
structure motif of the PDGF aptamer is a three-way helix junction
with a conserved single-stranded loop at the branch point; the helix
junction domain represents the core of the structural motif required
for high-afinity binding. 77
Figure 9.10 Schematic representation of PFGF and PDGF-receptor
nanosensors that operate based on modulation of the
photoluminescence quenching between PDGF AA-Au NPs
and Apt-Au NPs. h - Planck's constant; ν - frequency of
light. Reprinted with permission from Ref. 31. See also Color
Insert.