Information Technology Reference
In-Depth Information
The logic interconnect of this circuit should result in EYFP fluorescence
intensities that are inversely correlated with the IPTG input levels. However,
as shown in Figure 7.2 (the flat line), the circuit is completely unresponsive to
variations in the IPTG levels. The lack of response stems from the mismatch be-
tween the kinetic characteristics of the lacI /p(lac) gate versus the cI /
λ P(R O 12 )
inverter. Specifically, with no IPTG, the fully repressed expression level from
p(lac) still results in a low level of cI mRNA. Because the ribosome binding
site is very efficient, the low mRNA level results in some translation of the cI
protein. And because cI is a highly efficient repressor, even a low concentration
represses the
λ P(R O 12 ) promoter to the point where no fluorescence can be
detected. This gate mismatch highlights the importance of understanding the
device physics of the cellular gates. The following two subsections describe
genetic process engineering to modify genetic elements in the cI /
λ P(R O 12 )
inverter such that the gate obtains the desired behavioral characteristics.
Modifying Ribosome-Binding Sites
Ribosome-binding site (RBS) sequences significantly control the rate of trans-
lation from the input mRNA signal to the input protein (Figure 7.9). These
sequences align the ribosome onto the mRNA in the proper reading frame so
that polypeptide synthesis can start correctly at the AUG initiation codon. The
affinity of the ribosome's 30S subunit to the RBS that it binds determines the
rate of translation. This translation rate is included in a biochemical reaction
for modeling and simulating the inverter using BioSPICE [15, 16]. For a given
input mRNA level, a reduction in the translation rate yields a lower input protein
Orig: ATTAAAGAGGAGAAATTAAGC ATG
strong
RBS-1: TCACACAGGAAACCGGTTCG ATG
RBS-2: TCACACAGGAAAGGCCTCG ATG
RBS-3:
TCACACAGGACGGCCGGATG
weak
Figure 7.9 The ribosome, mRNA, and different ribosome-binding sites.
Search WWH ::




Custom Search