FastPCR Software for PCR, In Silico PCR, and Oligonucleotide Assembly and Analysis - DNA Cloning and Assembly Methods - page 279

The software allows the selection of any number of independent
PCR primer (or probe) designing tasks for each sequence using mul-
tiple combinations of “ [..] ” and -FpdN1-N2 , -RpdN1-N2 , or
-pdN1-N2 commands. Multiplex PCR can be carried out simulta-
neously within a single sequence with multiple tasks as well as for
different sequences with multiple tasks or a combination of both.
All possible combinations of “ [] ” (forward) with “ [] ”
(reverse) within the sequence(s):

1. []
2. ] [
3. [] []
4. [[]]
5. ([] [])n or/and ([[]])n.

5.4 User-Defined
PCR Product Size

The PCR product size can be specified in a similar way, with the
command: “ (N1-N2) ”; these values can be specified in the form
of minimum and maximum values for the product size. For
example, the “ (400-500) ” line defines that the product size
ranges from 400 to 500 base pairs. In case a user wants to specify
a fixed product size, the command should be a single number, for
example, “ (500) .” FastPCR is flexible and allows PCR product
sizes from 50 to 10,000 base pairs in length.

5.5 PCR Set-up
Examples with
Individual Commands

1. Where primers have already been designed, FastPCR can be
used to predict the optimal annealing temperature and PCR
product length for one or more predesigned primers (with the
“ -npd ” command, which prohibits the primer design). For
example, the command:
“-fpr[ggagagtagcttacctcgct cggtaaggttct-tcatgc]
-npd”
will analyze the selected sequence between the two primers (5′
ggagagtagcttacctcgct and 5′ cggtaaggttcttcatgc ).
2. Design primers with a difference in T m of about 10°, e.g., for
LATE-PCR:
“-Ftm50-55 -Rtm64-68 -pTMs10.”
3. Design primers with a specific restriction enzyme site at the 3′
end (“ -z3eNameEnzyme ”, “ -Fz3eNameEnzyme ”, “ -Rz3e
NameEnzyme ”) where “ NameEnzyme ” is the name of the
restriction enzyme: “ -z3eXceI .” The alternative command
(“ -c3NN ”) is also used for a special primer location. For exam-
ple, “ -c3YCATGR ” is the same as “ -z3eXceI ”: both com-
mands will design primers with the recognition site for Xce I
endonucleases 5′-YCATGR-3′ at the 3′ end of the primers.
4. Additional bases can be added to primer ends using the com-
mands “ -5eNN ” or “ -3eNN ,” where 5 or 3 denotes the end at