Biomedical Engineering Reference
In-Depth Information
Table 1
(continued)
Primer name a
Sequence (5′-3′) b
9C-yEmRFP+687c
CCCCCCCCCaccagttgaatgtctaccttcagc
SKLc-3CG9
ttataatttggaCCCGGGCCC
SKLc-5CG9
ttataatttggaCCCCCGGGG
SKLc-9C
ttataatttggaCCCCCCCCC
ScTDH3+1000
tgaatttactttaaatcttgcatt
3CG9-pEGFP+699c CCCGGGCCCgccgagagtgatcccggcggcggtc
a See Notes 1 and 2 for primer naming
b Overlap and GC-rich annealing sequences are indicated by capital letters
was isolated from the strains according to a standard method
[ 12 ] and used as a template. K . marxianus strain RAK3605
( ura3 ) [ 13 , 14 ] was used as a host for transformation.
2. Yeast extract-peptone-dextrose (YPD) medium: 1 % yeast
extract, 2 % polypeptone, 2 % glucose, and 2 % agar (if
necessary).
3. Synthetic dextrose (SD) drop out medium: 0.17 % yeast nitrogen
base without amino acids and without ammonium sulfate, 0.5 %
ammonium sulfate, 2 % glucose, and required nutrients [ 12 ].
4. Transformation mixture (TM): 40 % w/v polyethyleneglycol
3350 (Sigma-Aldrich), 200 mM lithium acetate, and 100 mM
dithiothreitol. PEG3350 was dissolved in hot sterile water
(60-80 °C), sterilized by autoclaving, and adjusted to fi nal
concentration of 60 % (w/v). 4 M lithium acetate solution was
prepared in water and autoclaved. 1 M dithiothreitol was pre-
pared in water and fi lter-sterilized. Fresh TM was prepared for
each transformation experiment just before the procedure by
mixing the above stock solutions.
5. Yeast transformation [ 14 ]: Yeast cells were inoculated with a
sterile toothpick from a fresh YPD plate into 50 mL YPD liquid
medium in a 250 mL Erlenmeyer fl ask. The cells were incu-
bated at 30 °C and grown to the stationery phase (18-24 h)
with shaking at 150 rpm. The cells were collected by centrifu-
gation and suspended in 2 mL TM by vortexing. Then the cell
suspension was transferred to a tube and centrifuged. The pellet
was suspended in 2.5 mL TM by vortexing and pipetting.
Aliquot of the cell suspension (50
μ
L) was transferred to a
microtube and 2-3
L of PCR-amplifi ed DNA fragment was
added. The mixture was incubated at 42 °C for 30 min.
Then, 150
μ
μ
L of SD was added, and the cell suspension was
Search WWH ::




Custom Search