Biomedical Engineering Reference
In-Depth Information
Table 1
PCR primer extensions and sequencing primers
Primer name
Sequence
Purpose
ORF forward
5′atatatGCTCTTCtAGT nnn
Amplifi cation of target ORF
ORF reverse
5′tatataGCTCTTCaTGC nnn
Amplifi cation of target ORF
INITforSQ
5′ATCTGTTGTTTGTCGGTGAACGC
Sequencing of 5
side of
insert in pINITIAL
′
side of
insert in pINITIAL
Nucleotides in lowercase can be substituted for other bases if needed for primer optimization. The triplet
nnn
indicates the fi rst ORF-specifi c codon of the primer. Ideally, it targets the second codon of the ORF
(forward primer) or the penultimate codon (reverse primer)
INITrevSQ
5′TGGCAGTTTATGGCGGGCGT
Sequencing of 3
′
12. LB agar plates: 10 g tryptone, 5 g yeast extract, 10 g NaCl, and
15 g agar. Adjust volume to 1 L with water. Sterilize by auto-
claving. Once the medium is cooled to ~60 °C, add the appro-
priate antibiotics, mix and pour the plates. Store plates at 4 °C.
13. LB medium: 10 g tryptone, 5 g yeast extract, and 10 g NaCl.
Adjust volume to 1 L with water. Sterilize by autoclaving.
Supplement with the appropriate antibiotics immediately prior
to use.
14. Autoclaved 87 % w/v glycerol.
15. Plasmid miniprep kit.
16. Chemical competent cells of an
E. coli
strain sensitive to CcdB
(virtually all
E. coli
strains lacking the F plasmid, e.g.,
E. coli
MC1061 [
23
]). Electro-competent cells may be substituted if
very high transformation effi ciencies are required.
17. Sequencing primers INITforSQ and INITrevSQ (Table
1
) to
verify sequences cloned into pINITIAL-derivatives or dedi-
cated sequencing primers for sequences cloned into expression
vectors.
2.2 Subcloning of
Sequence- Verifi ed
ORFs
1. 70 % w/v sucrose: 350 g sucrose. Adjust volume to 500 mL
with hot water. Mix well and dissolve and sterilize the sucrose
by autoclaving. Immediately after autoclaving determine
whether the sucrose has completely dissolved and if needed
carefully mix the solution until all the material is dissolved.
2. Low salt LB agar supplemented with 7 % w/v sucrose: 10 g
tryptone, 5 g yeast extract, 5 g NaCl, and 15 g agar. Adjust
volume to 0.9 L with water. Sterilize by autoclaving. Once the
medium is cooled to ~60 °C, add 100 mL sterile 70 % w/v
sucrose and the appropriate antibiotics, mix and pour the
plates. Store plates at 4 °C.
