Zebrafish Assays for Identifying Potential Muscular Dystrophy Drug Candidates - Zebrafish: Methods for Assessing Drug Safety and Toxicity - page 232

injection (hpi). Real-time quantitative reverse transcriptase PCR (qRT-PCR) was
performed at Beth Israel Medical Center qPCR core facility (Boston, MA). Total RNA
was isolated from zebrafish using RNAqueous-4PCR kit (Ambion, Austin, TX) and
2 mg of RNAwas reverse transcribed to cDNA using oligo dT primer and Omniscript
RT kit (Qiagen, Valencia, CA). Real-time PCR was performed in triplicate using
the QuantiTect probe PCR kit (Qiagen). Thermal cycling conditions included 95 C
for 15min, followed by 40 amplification cycles at 94 C for 15 s, followed by 60 C for
1min. TaqMan PCR primers against zebrafish dystroglycan gene (NM_173274) were
designed by Applied Biosystems (Foster City, CA). b-Actin primers used as an
internal control were synthesized by Applied Biosystems. Real-time PCR primer
sequences specific for dystroglycan were as follows:
forward primer, ACGACAACCAAGCCACCAA, reverse primer,
GGGTTACGCAGCTCAGGTTTTATAT, and the probe sequence was
6FAMCTGCAGTTATAGGCGATAGCMGBNFQ. Primer and probe
sequences for zebrafish b-actin were 5 0 -AGGTCATCACCATCGGCAAT-3 0 ,
5 0 -GATGTCCACGTCGCACTTCAT-3 0 , and 5 0 -ViC
CTTCCAGCCTTCCTTCCTGGGTATGGA-MGBNFQ-3 0 . All primers were tested
for nonspecific amplicons and primer dimers by visualizing PCR products on 2%
agarose gels before performing qRT-PCR and analyzing dissociation curves after
performing qRT-PCR.

18.2.7 Whole Mount Antibody Staining

Zebrafish were fixed in 4% paraformaldehyde (PFA) in phosphate-buffered saline
(PBS) for 2 h, rinsed, dehydrated, and stored in methanol at 20 C. Whole mount

staining using an anti-human dystroglycan monoclonal antibody was then performed
on fixed zebrafish samples that were rehydrated using standard methods

(Westerfield, 1993).

18.2.8 Fluorescence Microscopy

All fluorescence microscopy studies were performed using a Zeiss M2Bio fluores-
cence microscope (Zeiss, Thornwood, NY), equipped with a red rhodamine cube, a
green FITC filter (excitation: 488 nm, emission: 515 nm), a chilled CCD camera
(AxioCam MRm, Zeiss) equipped with 1.6

eye
pieces. Images were processed with AxioVision software Rel 4.6 (Zeiss) and Adobe
Photoshop 7.0 software (Adobe, San Jose, CA).

10 objective lenses, and 10

18.2.9 Myotome Length

Length of eight myotomes, two anterior and six posterior to the anal pore, was
measured using images of live 3dpf zebrafish. Images were analyzed using ImageJ
software (NIH, Bethesda, MD). The region of interest (ROI) was outlined using the
software drawing function and relative length was automatically measured.