Biomedical Engineering Reference
In-Depth Information
11. Place the dishes away from the air vents at the back of some TC
hoods, as they could unevenly dry out the agar layer. Dishes
that do not have the entire bottom surface evenly covered or
that have air bubbles in the base agar layer cannot be used.
12. The base agar layer can be prepared the day before and stored
at 4 °C overnight. Wrap the dishes in plastic bags to prevent
drying out of the agar layer. Ensure that the base layer has
reached room temperature before the top agar layer is added.
13. The agar temperature should not exceed 41 °C, as it might
induce a heat shock in the cells, undermining cell viability.
14. Any air bubbles that form can carefully be removed with a ster-
ile tip. Allow the top agar layer to solidify before moving the
dishes to the 37 °C incubator. If the agar layer is liquid at the
time of placing at 37 °C, the agar layer will not solidify.
15. Move the dishes carefully, as even modest shaking can separate
the top agar layer from the base layer, allowing the medium to
come between them and the top layer becoming extremely
fragile. The incubator that holds the soft agar dishes should sit
on a sturdy surface and preferably be infrequently used, as
repeated opening and closing of the door can result in shaking
of the dishes.
16. The medium atop the agar may be removed and replaced with
fresh medium, but there is a danger that the fragile agar layer
is disturbed. If not necessary, it is better not to remove the
medium.
17. Primers for G3PDH are: For: tgaaggtcggagtcaacggatttggt and
Rev: atgtgggccatgaggtccaccac.
18. Prepare a 1.0 % TAE agarose gel by weighing out 3.0 g agarose
and adding it to 300 mL of 1× TAE buffer. Melt the agarose
with a microwave and allow the gel mixture to cool to approxi-
mately 56 °C before casting the gel. Set up the casting tray and
comb of the horizontal gel system on a level surface. Add
15
L of 5 mg/mL ethidium bromide to the agarose solution.
Mix gently and pour the gel into the casting tray and allow it
to set. After it has set, remove the comb and transfer the tray
to the electrophoresis chamber. The comb end should be at
the cathode end. Add the 1× TAE buffer so that the gel is sub-
merged. Mix the PCR sample with loading dye, and load the
samples into the wells, loading a 100 bp DNA marker along-
side for reference. Run the gel until the dye front has reached
just past midway.
19. Wear safety glasses or a face shield when cutting out the bands
as UV light can be harmful for the eyes.
20. Purifi cation of DNA fragments with the QIAEX II system is
based on solubilization of agarose and selective adsorption of
ʼ
