Biomedical Engineering Reference
In-Depth Information
Fig. 2 COG subcomplexes selectively interact with COG partner protein Syntaxin 6. ( a ) Single COG subunit
hCOG6-3Myc, 2 plasmids containing 4 Lobe B COG-Myc subunits, 2 plasmids containing 4 Lobe A COG-Myc
subunits, or 4 plasmids containing all 8 COG-Myc subunits were transfected in HEK293T cells along with GFP-
tagged STX6. Cells were lysed in IP lysis buffer and then incubated with GBP beads. Bead eluates were run on
an SDS-PAGE gel and blotted with anti-Myc and anti-GFP antibodies. There are signifi cantly more of the lobe
B COG subunits that are co-immunoprecipitated by GFP-STX6 compared to individual COG6, lobe A, or even
the fully assembled COG complex ( b ). These results indicate a preference and level of selectivity of COG inter-
actions with assembled (sub)complexes
2. Primers designed to add AscI and PacI restriction digestion
sites on the COG-3Myc genes:
(a) Forward primer: GATAGGCGCGCCTGACCGCCCAA
CGACCC.
(b) Reverse primer: GAGCTTAATTAAGGGACCCCGTCC
CTAACCCACGG.
3. Multi-label kit from ATG Biosynthetics (Germany): contains
donor and acceptor fusion vectors ML-DGZ2x and
ML-DSZ2cx, donors and ML-AAZ6 and ML-AKZ1, accep-
tors, as well as competent piRHC + bacteria for cloning.
4. Cre recombinase (New England Biolabs, Ipswich, MA).
5. AscI and PacI restriction enzymes (New England Biolabs,
Ipswich, MA).
Search WWH ::




Custom Search