Bacterial Communities in Various Conditions of the Composting Reactor Revealed by 16S rDNA Clone Analysis and DGGE - Sustainable Biotechnology: Sources of Renewable Energy - page 170

reactor (reactors A, B, and C), 16S rDNA-clone analysis was performed to compare
difference in the bacterial communities under each set of conditions, and in the
large-scale reactor, both 16S rDNA-DGGE and clone analysis were performed to
analyze how bacterial community succession changes day by day.
3.2 Extraction of Community DNA from Samples
Community DNA was obtained from samples by using a kit for extracting DNA
from soil samples, e.g. UltraClean Soil DNA (Mo Bio Laboratories, USA), which
includes different scales, and their use is recommend depending on the sample
condition.
3.2.1 16S rDNA Clone Analysis
Construction of 16S rDNA Clone Library
Community DNA was used as the template DNA. Bacterial partial 16S rDNA
(about 1,500 bp) was amplified by PCR with a forward primer B27F (5 -
AGAGTTTGATCCTGGCTCAG, Escherichia coli position 9-27) and a reverse
primer U1492RM (5 -GGYTACCTTGTTACGACTT, E . coli position 1512-1492)
[17]. Amplification by PCR comprised 25 cycles of 30 s at 94 ◦ C, 30 s at 60 ◦ C,
1.5 min at 72 ◦ C, and a final extension of 5 min at 72 ◦ Cusing Ex Taq DNA
polymerase (Takara Bio, Japan). PCR products were purified using a DNA purifi-
cation kit (e.g. GFX PCR DNA and Gel Band Purification Kit, GE Healthcare,
UK) and cloned into the plasmid vector (e.g. pT7Blue T-Vector, Novagen,
Germany).
Transformation of E . coli and Sequencing of 16S rDNA Clone Library
E . coli strain DH5 alpha was transformed with this plasmid library. Plasmid
DNAs were prepared from the cultures. The 16S rDNAs were sequenced using
an appropriate DNA sequencer (e.g. DNA Analyzer 3730 xl , Applied Biosystems,
USA).
Homology Search and Estimation of Phylogenetic Affiliations
A homology search was conducted using BLASTN database (BLAST,
http://www.ncbi.nlm.nih.gov/BLAST /) [18]. Checks for chimeric sequences were
conducted using the software Pintail [19] which is available from the Ribosomal
Database Project, followed by NCBI BLASTN database [18].
Analysis of Homologous Coverage
Coverage of the clone library describes the extent to which the sequences in the
library represent the total population. In order to calculate the coverage of a library,
the criterion for what constitutes a unique sequence must first be decided. Various
studies have used different criteria, generally based on sequence similarity (e.g. 97