Information Technology Reference
In-Depth Information
special class of RNA, called messenger RNA, and the process of its synthe-
sis is called transcription.
During transcription the sequence of a gene is copied into an mRNA, us-
ing one strand of the DNA molecule as template (Figure 1.5). The rules of
complementarity in DNA/RNA double-strands are much the same as in DNA,
with rA pairing with dT (“r” stands for RNA and “d” for DNA), rU pairing
with dA, rG with dC, and rC with dG. According to the complementary rules,
an exact copy of the gene is made in the form of an mRNA. This messenger
RNA, containing all the necessary signals for protein synthesis, namely the
“start” and “stop” signals, is carried to the appropriate place in the cell and
used as template for protein synthesis. For example, in eukaryotes, the mRNAs
synthesized in the nucleus must go to the cytosol where the machinery of
translation is located.
5'
3'
ACTGCCCATGAAACGATTCAGTGATGGCTGACAC
DNA
TGACGGGTACTTTGCTAAGTCACTACCGACTGTG
3'
5'
5'
3'
ACUGCCCAUGAAACGAUUCAGUGAUGGCUGACAC
mRNA
start
signal
stop
signal
Figure 1.5.
Relationship of the DNA to the mRNA. Note that the mRNA is
complementary to the DNA strand from which it is transcribed. Note also that
there are sequences upstream of the start signal and sequences downstream of the
stop signal that will not be translated into amino acids. The sequence shown here
is unrealistically short to illustrate both the start and the stop signals.
As I said earlier, the need for an mRNA intermediate makes sense in the
environment of the cell, but is of little use in simple computer systems such
as gene expression programming, in which small and simple genomes are
currently devoid of sophisticated mechanisms of regulation of gene expres-
sion. Perhaps in the near future we will see sophisticated GEP-like computer
systems with more complex genomes and capable of complex somatic dif-
ferentiation. Maybe then an mRNA-like intermediate will be necessary to
ensure a differential pattern of gene expression.
