Biology Reference
In-Depth Information
Species identification
DNA typing has been used in taxonomy for the categorization of species. The same
methods as used in this science can be utilized by forensic science. The locus of
choice must have very little intraspecies variation, such that all members of the same
species have the same DNA type. Equally, the locus used needs to have sufficient
interspecies variation such that members of one species can be separated from mem-
bers of the next closely related species. In animals, gene loci on the mitochondrial
genome fit these criteria best, primarily as mitochondria do not contain an error read-
ing enzyme to repair DNA bases added incorrectly during DNA replication [1]. As
such, mitochondrial DNA mutates five times faster than nuclear DNA. The analysis
of genes on the mitochondria also has the advantages of being present at very high
copy number [2].
The mitochondrial locus used most commonly in taxonomy and forensic sci-
ence is the cytochrome
b
gene. The human cytochrome
b
gene lies at position
14 756
−
15 896, adjacent to the hypervariable region I (HVI) (see Figure 13.1). In all
mammalian species, this gene lies in the same position but because of the variation in
the size of mammalian species its base position alters. It encodes a protein, 380 amino
acids in length, involved in the oxidative process of respiration. DNA sequences for
over 8000 different species have been decoded and registered with one of the DNA
databases, such as EMBL (www.ebi.ac.uk) or GenBank (www.ncbi.nlm.nih.gov).
The complete gene is 1140 bases in length and too large for standard PCR-based
amplification, especially from forensic evidence that is often degraded. As this is
a gene for an enzyme used in respiration, parts of the protein are under selection
pressure, and therefore similar in a large number of diverse species. An example of a
sequence alignment is shown in Figure 14.2. This allows the development of primer
sets that will work on all mammalian species. The DNA sequences between the
conserved regions shows sufficient variation such that members of closely related
Consensus GCTCCCTACTAGGAATCTGCCTAATCTTACAAATCCTAACCGGACTATTC
Indian Rhino.......GT...........T..........G........A.........
Javan Rhino ........T...........T..........G.....G..A.........
White Rhino .......G............T.............T...............
Black Rhino ....T.....................C......................T
Sumatran ..................................................
Unknown 1 .......G............T.............T...............
Unknown 2 .......G............T.............T...............
Unknown 3 ....T.....................C......................T
Unknown 4 ....T.....................C......................T
Unknown 5 ....T.....................C......................T
Figure 14.2
Showing an alignment of 50 bp within the cyt
b
gene for the four extant species of
rhino (Black and White live in Africa and the Indian, Java and Sumatra are the Asian relatives)
compared to five bone samples of unknown species. Unknown 1 and 2 have a 100% match to the
White Rhino and Unknown 3, 4 and 5 are the same and are a 100% match to the Black Rhino
