Biology Reference
In-Depth Information
identified using Opr3-RP (5¢-ctcaaatattggcgagacctg-3¢) and Opr3-LP (5¢-
GGCAGAGTATTATGCTCAACG-3¢).
pMYB24::GUS Transgenic Plants
To make the pMYB24::GUS construct, a 3098 bp (68 bp upstream of MYB24
start codon ATG) genomic DNA fragment was PCR amplified from Col-0 ge-
nomic DNA using primers 18F (PstI, 5¢ TTCTAGGCTGCAGCTAAAC-
GACTTC 3¢) and 2934R (5¢ GTAATAGAAAGGGAGAGTTGTGAAAG
3¢). PCR amplifications of promoter regions were performed using PfuTurbo
DNA polymerase (Stratagene). The amplified DNA fragment was digested with
PstI and then cloned into PstI/NcoI-cleaved pCambia 1301 vector and their se-
quences were confirmed by sequencing. The pMYB24::GUS fusion construct was
then introduced into Arabidopsis thaliana ecotype Col-0 plants using flower dip
method [19]. More than three independent lines were examined at various stages
of floral development in this study.
In Situ Hybridization
Whole inflorescences which included unopened flower buds were fixed and in situ
hybridization was carried out as described before [8]. Antisense and sense probes
of MYB21 (+294 to +801 nt, nt stands for nucleotides, the A of the start codon
ATG = 1) for in situ hybridization were DIG-labeled by in vitro transcription.
Authors' Contributions
Conceived and designed the experiments: DX JP. Performed the experiments: HC
SS LX HMS ZC. Analyzed the data: HC SS LX ZC DX JP. Contributed reagents/
materials/analysis tools: LX. Wrote the paper: DX JP.
References
1. Smyth DR, Bowman JL, Meyerowitz EM (1990) Early flower development in
Arabidopsis. Plant Cell 2: 755-767.
2. Chaudhury AM (1993) Nuclear genes controlling male fertility. Plant Cell 5:
1277-1283.
3. Taylor PE, Glover JA, Lavithis M, Craig S, Singh MB, et al. (1998) Genetic
control of male fertility in Arabidopsis thaliana: structural analyses of postmei-
otic developmental mutants. Planta 205: 492-505.
Search WWH ::




Custom Search