Reduced Placental Taurine Transporter (TauT) Activity in Pregnancies Complicated by Pre-eclampsia and Maternal Obesity - Advances in Experimental Medicine and Biology - page 81

9.2.2 Quantitative PCR Analysis of TauT mRNA Expression

Placental tissue was lysed and total RNA extracted using Absolutely RNA Miniprep Kit
(Stratagene, USA). RNA was quantified using Quant-iT Ribogreen kit (Molecular
Probes) and 100 ng of total RNA from each sample reverse transcribed using Af fi nityScript
cDNA synthesis kit with random primers (Stratagene, USA). mRNA for TauT (SLC6A6)
and b-actin were quantified by QPCR using Stratagene's MX3000P real-time PCR
machine and Brilliant SYBR Green I QPCR mastermix (Stratagene, USA) as described
previously (Desforges et al. 2006 ). Primers (MWG-Biotech) for SLC6A6 (forward: 5¢
CGTACCCCTGACCTACAACAAA 3¢, reverse: 5¢ CAGAGGCGGATGACGATGAC
3¢) and b-actin (Lacey et al. 2005 ) were used at a final concentration of 200 nM. QPCR
data are presented as median values of percentage expression relative to a 40-week pla-
cental sample, designated the calibrator, which was included in each QPCR run as an
internal standard (Lacey et al. 2005 ). The data were analysed by Kruskal-Wallis and
Dunn's post hoc tests and p < 0.05 was considered significant.

9.2.3 Western Blot Analysis

Protein was extracted from placental villous homogenates and Western blot analysis
of TauT and b-actin protein expression carried out as described previously
(Champion et al. 2004 ; Desforges et al. 2006 ) using a rabbit anti-TauT affinity-
purified polyclonal antibody (Alpha Diagnostics. 1:400 dilution; 2.5 m g/ml). For a
negative control, the purified TauT antigenic peptide was used in 5× excess to pre-
absorb the antibody. Primary and horseradish peroxidase-conjugated secondary
antibody incubations were performed for 1 h at room temperature. Positive signals
were detected using ECL and the density of the immunoreactive species was
assessed using a GS 700 Imaging Densitometer (Bio-Rad Laboratories, Hemel
Hempstead, UK) with Molecular Analyst software. Data were analysed using a
Mann Whitney test and p < 0.05 was considered signi fi cant.

9.2.4 TauT Activity Measurements and Effect of Neuropeptide Y

Placental villous fragments were dissected and rinsed in a 1:1 or 1:3 mix of Dulbecco
modified Eagle medium (DMEM)/control Tyrode's buffer (135 mM NaCl, 5 mM
KCl, 1.8 mM CaCl 2 , 1 mM MgCl 2 , 10 mM Hepes, 5.6 mM glucose, pH 7.4). Uptake
of 3 H-taurine (5/10 mM; 0.5/1 mCi/ml) into villous fragments was measured in con-
trol and Na + -free Tyrode's buffer (135 mM choline chloride replaced NaCl, pH 7.4)
as previously described (Greenwood and Sibley 2006 ) . The Na + -dependent compo-
nent of 3 H-taurine uptake, representing TauT activity, was calculated and expressed
per mg fragment protein. The uptake of 3 H-taurine at initial rate was considered to