Biology Reference
In-Depth Information
Table 26.1 Primer sequence for the real-time transcription-polymerase chain reaction used
in the experiment
Gene name
Accession number
Sequence of the primer (5¢ -3 ¢ )
Glyceraldehyde-3-phosphate
dehydrogenase (GAPDH)
NM 008084
F:TGTGTCCGTCGTGGATCTGA
R:TTGCTGTTGAAGTCGCAGGAG
Tyrosine hydroxylase
(TH)
NM 009377
F:TCTCAGAGCAGGATACCAAGCA
R:GCATCCTCGATGAGACTCTGC
Tryptophan hydroxylase
(TPH)
NM 009414
F:TTGGGCTGTGCAAACAAGATG
R:TGTTTACAGGCAATCTTGGGATCA
Dopamine- b -hydroxylase
(DBH)
NM 138942
F:TCCATCTGGATTCCCAGCAAG
R:ATGCAGGCCTGAGGTGTTGA
(TaKaRa Code:TP800). At the end of the cycles, melting temperatures of the PCR
products were determined to be between 57 and 95°C. GAPDH mRNA was used as
an internal control to measure the relative quantitation of the expression of the tar-
get genes. Data were analyzed by comparative threshold cycle method (D D CT).
Then, the relative expression level of tyrosine hydroxylase (TH), tryptophan
hydroxylase (TPH), and dopamine-b-hydroxylase (DBH) were normalized against
the expression of GAPDH.
26.2.7
Statistical Analysis
Data were analyzed using SPSS program version 10.0 (SPSS Inc., Chicago, IL).
Values are presented as means ± SD. The analysis of variance (ANOVA) test was
used to compare the means of different groups of data, followed by LSD and
Dunnett's T3 test. P < 0.05 was considered to be significant.
26.3
Results
26.3.1
Effect of Taurine on Synaptic Ultrastructure
in the Brains of Mice Exposed to As
The ultrastructure of synapse in the brain in the experiments was observed in
Fig. 26.1 . Abundant synaptic vesicles in synapse of mouse brains were shown in the
controls (Fig. 26.1a ), while the less synaptic vesicles were observed in the brain of
mice exposed to 4 ppm As 2 O 3 (Fig. 26.1b ). The synaptic vesicles in the synapse of
mouse brains exposed to 4 ppm As 2 O 3 and 150 mg/kg taurine were more than that
in the group exposed to 4 ppm As 2 O 3 alone (Fig. 26.1c ).
 
Search WWH ::




Custom Search