Molecular Analysis of Mitochondrial DNA Point Mutations by Polymerase Chain Reaction - Clinical Applications of PCR - page 136

Table 1
Primer Sequences

Forward (F)/ PCR

Primer Primer site Reverse (R) Sequence (5'-3') product size

mtF3130 3130-3149 F AGGACAAGAGAAATAAGGCC 651 bp

mtR3758 3758-3780 R AGTAGAATGATGGCTAGGGTGAC

mtF8278 8278-8297 F CTACCCCCTCTAGAGCCCAC 216 bp

mtR8475 8475-8493 R TTTATCCCGTTTGGTCAGG

mtF8768 8768-8785 F CAACTAACCTCCTCGGAC 432 bp

mtR9199 9199-9180 R TGTCGTGCAGGTAGAGGCTT

mtF11688 11688-11705 F CCGGCGCAGTCATTCTCA 672 bp

mtR12360 12360-12342 R GGTTATAGTAGTGTGCATG

mtF14437 14437-14455 F AGGATACTCCTCAATAGCC 748 bp

mtR15185 15202-15185 R GGCGGATAGTAAGTTTGT

mutations in mitochondrial DNA (mtDNA) and a threshold effect further com-
plicate the diagnosis. Currently, the most commonly known syndromes associ-
ated with specific mtDNA point mutations are myopathy, encephalopathy,
lactic acidosis, and stroke-like episodes (MELAS); myoclonic epilepsy and
ragged red fibers (MERRF); neuropathy, ataxia, and retinitis pigmentosa
(NARP); and Leber's hereditary optic neuropathy (LHON) ( 1-3 ) . A total of 11
point mutations can be analyzed using two single polymerase chain reaction
(PCR) assays and one multiplex PCR containing three pairs of primers. Detec-
tion of these point mutations is achieved by amplification of the DNA regions
containing the point mutations followed by allele-specific oligonucleotide
(ASO) hybridization ( 4 ) .

2. Materials
1. Extracted genomic DNA from patient's tissues ( 5 , 6 ) .

2. PCR primers ( 4 , 7 ) . Stock solutions are 100 µ M stored in a -20°C freezer. Work-

ing solutions are 10 µ M . Primers are listed in Table 1 .

3. ASO probes ( 4 , 7 ) . Stock solutions are 100 µ M and stored at -20°C. Working

solutions are 10 M . ASO probes are listed in Table 2 . The nucleotide positions

where the mutations occur are in bold (see Note 1 ).

µ

4. PCR reagents:

a. 10X PCR buffer II (Applied Biosystems, Inc. [ABI]).
b. dNTP 8 m M solution.
c. 25 m M MgCl 2 .
d. Ampli Taq or Taq Gold DNA polymerase (ABI).

5. Church prehybridization and hybridization buffer: 0.5 M Na 2 HPO 4, pH 7.2, 1 m M

ethylenediamine tetraacetic acid (EDTA), and 7% sodium dodecyl sulfate (SDS).