Capsid Modification Strategies for Detargeting Adenoviral Vectors - Adenovirus: Methods and Protocols - page 53

interactions with blood clotting factors, most importantly Factor
(F) X. Here we overview the strategies we have used to replace the
5th and the 7th HVRs from Ad5 with those from the species D,
low seroprevalence, non-FX interacting Ad26.
To genetically manipulate the hexon protein, we developed a
hexon shuttle plasmid suitable for homologous recombination
strategies with the full lengh Ad genome. We previously described
the protocol we have used to generate a hexon shuttle plasmid
using the primers 5 ′ CTCCTTATTCCACTGATCGCC 3 ′ and 5 ′

ATCTGATCTCCGACAAGAGCG 3 [ 25 ]. This results in the

amplifi cation of the hexon gene incorporating an additional fl ank-
ing 1 Kb DNA from the unique BamH I and AsiS I restriction sites
present in the Ad5 genome. We used this shuttle plasmid for our
strategies for swapping hexon HVR regions from Ad26.

′

To generate vectors with HVR7 from the low seroprevalence ade-
novirus, Ad26 swapped into the Ad5 vector, we used the following
strategy.

3.1.4 Generating Ad5
Containing HVR 7
from Ad26

1. Using the Ad26 cosmid, PCR amplify a fragment (fragment 1;
131 bp) using the oligonucleotides 9 and 12 to generate the
Ad26 HVR7 fragment with Ad5 overlaps at either end.
2. Using the Ad5 cosmid (or hexon shuttle plasmid), PCR amplify
an Ad5 hexon fragment (fragment 2; 575 bp) from the Nde I
site until HVR7 using oligonucleotides 7 and 10.
3. Using the Ad5 cosmid (or hexon shuttle plasmid), PCR amplify
an Ad5 hexon fragment (fragment 3; 1,391 bp) from HVR5
until the Bam HI site using oligonucleotides 8 and 9.
4. By PCR, fuse fragment 1 (131 bp) with fragment 2 (575 bp)
using oligonucleotides 7 and 12, resulting in a fragment (frag-
ment 4) of 686 bp.
5. By PCR, fuse fragment 4 (686 bp) and fragment 3 (1,391 bp)
by PCR using oligonucleotides 7 and 8 resulting in a hexon frag-
ment of 2,059 bp containing the HVR7 of Ad26 ( see Note 4 ).

6. Using the restriction endonucleases Bam HI and Nde I, sub-
clone the generated fragment back into the hexon shuttle
plasmid.
7. Sequence the insert to confi rm presence of the correct modifi -
cation, and to check no other mutations have been introduced
by the PCR procedures.
8. For homologous recombination, linearize the hexon shuttle
vector using Asi SI, and rescue the full length genome using
BJ5183 electroporation competent cells, as described previ-
ously ( see Note 3 ).
9. Rescue recombinant adenoviral vectors using permissive cells
(e.g. 293 cells) as described previously ( see Note 3 ).