Biology Reference
In-Depth Information
3. Proteinase K: 20 mg/mL proteinase K (Macherey-Nagel)
dissolved in proteinase buffer.
4. Proteinase buffer: 100 mM Tris-HCl, 100 mM EDTA, 2.5 %
SDS, pH 8
5. SYBR Green Real-Time PCR Master Mix, to be used 1:2 (Life
Technologies).
6. HD Human adenovector (pC4HSU and pC4HSUgfp; [ 11 ])
5
M primers.
HD-V For 5
μ
ccaccactacatagcccacagt 3
,
.
7. HD canine adenovector (HD-CAV-2 [ 12 ]) 5
HD-V Rev 5
acaaagaatggctgagcaagc 3
μ
M primers:
GFP For 5
caacagccacaacgtctatatcatg 3
,
.
8. Optical 96-well reaction plates (Life Technologies).
9. Optical adhesive fi lms (Life Technologies).
10. Real-Time PCR System 7300 (Life Technologies).
GFP Rev 5
atgttgtggcggatcttgaag 3
2.3 RNA Extraction,
Analysis, and
Quantifi cation
1. Qiagen RNeasy mini kit.
2. DNase, RNase free, dissolved in water and stored at −20 °C.
3. Cell Scrapers.
4. Agilent RNA 6000 Nano LabChip kit.
2.4 RNA
Retro- Transcription
1. Reverse transcriptase: 200 U/
L SuperScript III Reverse
Transcriptase (Life Technologies).
2. PCR grade 10 mM dNTPs (Life Technologies).
3. Random hexamers: prepare a 3
μ
μ
g/
μ
L solution (Life
Technologies).
4. RNase Inhibitor: 40 U/
L RNaseOUT™ (Life Technologies).
5. First-Strand Buffer, to be used 1:5 (Life Technologies).
6. DEPC-treated water (Life Technologies).
7. DTT: prepare a 0.1 M solution.
μ
2.5 Gene
Expression Arrays
1. Affymetrix Human Genome U133 Plus 2.0 Array.
2. 3
IVT Express kit.
3. GeneChip hybridization, wash and stain kit.
4. Affymetrix GeneChip Instrument System.
2.6 Gene Chip
Validation by TaqMan
Assays
1. TaqMan ® Gene Ex Assays (Life Technologies) to be used 1:20.
2. TaqMan Real-Time PCR Master Mix (Life Technologies) to
be used 1:2.
3. Optical 96-well reaction plates (Life Technologies).
Search WWH ::




Custom Search