Biology Reference
In-Depth Information
2.6. Throat Swabbing
1. 2-mL yellow-capped tubes, sterile.
2. Cotton-tipped throat swabs, sterile.
3. Selective strep agar plates with 5% sheep blood (cat.# 221780; BD Biosciences,
San Jose, CA, USA).
4. 100 m
M
dithiothreitol (DTT), sterile.
5. PCR reagents and machine.
6.
emm
PCR primers (forward: CTATTSGCTTAGAAAATTAA and reverse:
GCAAGTTCTTCAGCTTGTTT).
7. Agarose gel electrophoresis equipment.
8. Vortex.
9. Racks for 1.5-/2-mL tubes.
10. 1.5-mL tubes for serial dilutions, sterile.
11. PBS.
12. Ethanol.
13. Glass spreader.
14. 100 blood agar plates.
15. Light box.
16. Colony counter.
17. Disposable absorbent bench covers.
18. Liquid nitrogen.
2.7. Saliva Aspiration
1. 2-mL blue-capped tubes, sterile.
2. 1-mL syringes, sterile.
2.8. Nasal Washes
1. 2-mL white-capped tubes, sterile.
2. 1-mL syringes, sterile.
3. PBS.
3. Methods
3.1. Preparation of Bacterial Inoculum
GAS is prepared for infection of non-human primates by first growing the
wild-type and mutant strains in THY broth to mid-exponential phase as detailed
below. This step should be performed 2-3 weeks prior to monkey infection
to enable adequate time to generate accurate bacterial titers and repeat the
culturing step if necessary. Accurate bacterial titers are essential to ensure an
equal infectious dose is given to each animal.
Search WWH ::
Custom Search