Phylogeographic Analysis of Tick-borne Pathogen - Recent Advances and Issues in Environmental Science - page 82

TACAACGCAACGCTTGAG3' and MSP1a3: 5'GCTTTACGCCGCCGCCTGC-
GCC3' and cloned into pGEM-T vector (Promega, Madison, WI, USA) as reported
previously [20]. Three independent clones for each of the MSP1a constructs were
transformed in E. coli JM109 cells and grown for 15-20 hr at 37°C. Culture vol-
umes of 3 ml were used for RNA and DNA extraction using TriReagent (Sigma, St.
Louis, MO, USA) according to manufacturer's instructions. The RNA samples were
treated with RNase-free DNase (Invitrogen, Carlsbad, CA, USA) prior to RT-PCR.
MSP1a mRNA levels were characterized by real-time RT-PCR using oligonucleotide
primers MSP1RT5: 5'ACCAATCGTTGGCAGAAGAG3' and MSP1RT3: 5'ACCT-
GCTCCCAAAGTAGCAA3' and normalizing against E. coli D-1-deoxyxylulose
5-phosphate synthase gene ( dxs ) [34] and plasmid DNA copy number by msp1alpha
PCR using the oligonucleotide primers and conditions described above. Real-time RT-
PCR was conducted using the iScript One-Step RT-PCR Kit with SYBR Green and an
iQ5 thermal cycler (Bio-Rad, Hercules, CA, USA). Control reactions were performed
using the same procedures but without reverse transcriptase to test for DNA contami-
nation in the RNA preparations and without RNA added to detect contamination of the
PCR reaction. The normalized mRNA levels were compared between different MSP1a
constructs using an ANOVA test (P = 0.05).
Anaplasma marginale MSP1a Repeat Sequences Show Ecoregion-specific
Signatures
Ecoregion clusters showed different NDVI, temperature and rainfall values (Figure 1).
Ecoregion cluster 1 extended over large areas of central Africa and central South Amer-
ica, primarily Argentina and southern Brazil. It involved a region with medium to high
NDVI values with a clear seasonal decrease between June and September. This was
the ecoregion with the highest recorded temperature and around 1,000 mm of annual
rainfall. Ecoregion cluster 2 included vast areas of the Mesoamerican corridor, northern
South America and a small territory of eastern South Africa. It consisted of zones with
high NDVI along the year without seasonal variability, temperature values similar to
those in ecoregion cluster 1 and rainfall around 1,500 mm/year. Ecoregion cluster 3
extended over central South Africa and scattered parts of southern USA and Mexico,
with the lowest NDVI values and little change across the year. This ecoregion dis-
played lower temperature values and the minimum rainfall. Finally, ecoregion cluster
4 extended over large areas of USA and had a clear NDVI signature, very low between
November and March and then rising to reach maximum levels around July. This area
was the coldest among all the ecoregion clusters and rainfall was around 800 mm/year.
Figures 2 and 3 display the association of the A. marginale strains with the four
ecoregion clusters. These fi gures are plotted according to the values of the fi rst two
axes derived from PCA on NDVI time series. Figures plot the 80% confi dence ellipses
of the annual mean NDVI and the seasonal variation of NDVI for each ecoregion
cluster, as well as the plot of the isolates in the NDVI envelope. Analysis showed that
77% of MSP1a R1 unique sequences were associated with only one ecoregion cluster
(Figure 2). Ten R1 unique sequences (25.6% of the total number of R1 sequences)
were reported exclusively in ecoregion cluster 1 and they shared 16 out of 31 amino
acids (51.6% of the total number of amino acids; Table 2). Six R1 unique sequences