Family Retroviridae - Viruses And Human Disease

The most important hepadnavirus is hepatitis B virus,

nation with the host or with other viruses. Based on these

which is a major cause of hepatitis in humans. Like hepatitis

sequence relationships, the retroviruses that infect birds and

C virus, it often establishes a chronic infection that can result

mammals are classified into six genera, as illustrated in Fig.

in cirrhosis or hepatocellular carcinoma.

6.1 and as listed in Table 6.1. Of these, members of three gen-

era are characterized as simple retroviruses, which encode

only the genes gag, pro, pol, and env (and sometimes dut).

FAMILY RETROVIRIDAE

The other three genera of retroviruses of higher vertebrates, as

well as the fish viruses, encode, in addition, regulatory genes

The retroviruses are a very large group of viruses that

that control their life cycle, and they are called complex ret-

infect invertebrates as well as vertebrates. Most of what

roviruses. Notice that these regulatory genes independently

we know about this group of viruses comes from studies of

entered the four different lineages of complex retroviruses

viruses that infect birds or mammals. Hundreds have been

represented by the four different genera (Fig. 6.1). Thus,

studied and, although considerable divergences exist, they

recombination to acquire new functions has been an ongo-

form a well-defined taxon. All are sufficiently similar to be

ing process in the retroviruses. Also notice that the complex

classified as belonging to a single family, the Retroviridae.

retroviruses do not group together. The epsilonretroviruses

The family gets its name from the concept that these viruses

are more closely related to the gammaretroviruses, which are

use retrograde flow of information, from RNA to DNA,

simple viruses, than they are to other complex retroviruses,

whereas the conventional flow of information in living

and the deltaretroviruses, lentiviruses, and spumaviruses are

organisms is from DNA to RNA.

not particularly closely related.

The RTs of retroviruses are the most highly conserved

Members of the different genera differ in their structure

elements of these viruses and have been used to study the

as visualized in the electron microscope. The simple viruses

relationships among them. Figure 6.1 illustrates the relation-

were formerly classified on the basis of morphology into

ships among the retroviruses of higher vertebrates based on

groups A, B, C, and D. The nucleocapsids of C-type viruses,

the sequences of their RTs. Included in the tree is a line-

now classified as alpharetroviruses and gammaretroviruses,

age of fish viruses, now classified as members of the genus

assemble during budding, and the nucleocapsid is centrally

Epsilonretrovirus. The tree is annotated to show where vari-

located in the mature virion. The nucleocapsids of B-type

ous new genes entered different virus lineages via recombi-

and D-type viruses, now classified as betaretroviruses,

Virus

Genus

MLV

new env

FeLV

Gammaretrovirus

HERV-C

WDSV

Epsilonretrovirus

orfA, orfB, orfC

HSRV

Spumavirus

bel1, bel2

HIV-1

tat, rev

HIV-2

Lentivirus

EIAV

VMV

dut

MPMV

new env

sag

Betaretrovirus

MMTV

HERV-K

IAP

RSV

Alpharetrovirus

BLV

PTLV-1

Deltaretrovirus

tax, rex

PTLV-2

FIGURE 6.1

Phylogenetic tree of the Retroviridae drawn from the amino acid sequences of the reverse transcriptases.

The lengths of the branches are proportional to the degree of divergence; the names of the "simple" retrovirus genera

are boxed in black, the "complex" genera are boxed in red. The greenish ovals indicate the acquisition of new genes

during the evolution of current extant viruses. Most of the virus name abbreviations are found in Table 6.1; HERV-C and

HERV-K are defective retroviruses in the human genome and IAP is a virus-like element in rodent genomes. Adapted

from Coffin et al. (1997) Figure 6 on p. 43. and Fields et al. (1996) p. 1769.

TABLE 6.1 Retroviridae

Virus name

World

Genus/members

abbreviation

Host(s)

Transmission

Disease

distribution

Orthoretrovirinae

Alpharetrovirus (simple) formerly avian type C retroviruses

Avian leukosis

ALV

Birds

Worldwide

Rous sarcoma

RSV

Birds

Gammaretrovirus (simple) formerly mammalian type C retroviruses

Moloney murine leukemia

MLV

Mice

T-cell lymphoma

Feline leukemia

FeLV

Cats

T-cell lymphoma,

immunodeficiency

Betaretrovirus (simple) formerly mammalian type B and type D retroviruses

Mouse mammary tumor

MMTV

Mice

Vertical, including

Mammary carcinoma,

Worldwide

mothers' milk

T-cell lymphoma

Mason-Pfizer monkey

MPMV

Monkeys

Unknown

Deltaretrovirus (complex) formerly the BLV/HTLV group

Bovine leukemia

BLV

Cows

B-cell lymphoma

Primate T-lymphotropica

PTLV-1

Humans

Vertical, including

T-cell lymphoma,

mothers' milk, sexual

neurological

transmission, blood

disorders

TSP, HAMb

PTLV-2

Humans

Epsilonretrovirus (complex)

Walleye dermal sarcoma

WDSV

Fish

Benign sarcomas

North America

Lentivirus (complex)

Human immunodeficiency

HIV-1

Humans

Neonatal infection,

AIDS

Worldwide

HIV-2

Humans

sexual transmission, blood

Simian immunodeficiency

SIV

Monkeys

Simian AIDS

Africa

Visna-maedi

VISNA

Sheep

Neurological disease

No. Europe

Equine infectious anemia

EIAV

Horses

Anemia

Current epidemic in

Utah

Spumaretrovirinae

Spumavirus (complex)

Chimpanzee foamy

CFV

Monkeys

None

Human spumaretrovirus

HRSV

Humans

Primate T-lymphotropic virus 1 (PTLV-1) was formerly known as T-cell leukemia virus (HTLV).

TSP, tropical spastic pareparesis; HAM, HTLV-associated myelopathy.

assemble before budding and the nucleocapsid is eccentri-

evolving with the eukaryotes for a long period of time. The

cally located (type B) or bar shaped (type D) in the mature

integrated copies of retroviruses in the germ line constitute

virion (see Figs. 2.1 and 2.21).

a form of fossil record that allows us to trace the lineage of

Eukaryotic genomes contain a very large number of

at least some retroviruses for 100 million years or longer.

genetic elements that are related to retroviral genomes.

For other viruses, whether RNA or DNA, we can only trace

Retrotransposons encode RT and can move around within

ancestry for much shorter periods of time.

the genome by a process that uses reverse transcription and

insertion, similar to what happens with retroviruses. They

Retroviral Genome

are related to retroviruses but have no independent lives as

viruses. Other elements in the eukaryotic genome contain

The RNA genome in the retrovirion is diploid, consisting

additional retrovirus-like genes and appear to have arisen by

of two copies of a 7- to 10-kb single-stranded (ss)RNA that

insertion of retroviral genomes into the germ line at some

is capped and polyadenylated. The two copies of the genome

time in the past. Some of these are still active, capable of

are normally identical, but during mixed infection hybrid

genomes can result. They are joined near their 5¢ ends, and

giving rise to infectious retroviruses, whereas others are

defective. It is clear that this class of elements has been co-

perhaps in other regions as well, by hydrogen bonds.

Reverse Transcription of Viral RNA

All retroviruses encode the four genes called gag, pro, pol,

and env, which are always found in this order in the genome.

A schematic overview of the life cycle of a retrovirus

A simplified illustration of a retroviral genome, its relation to

was presented in Fig. 1.13. Most retroviruses penetrate into

the provirus, and the locations of the different gene products

a cell by fusion with the plasma membrane, but some use the

in the virion are shown in Fig. 6.2. The name gag comes from

endosomal pathway. Once inside the cell, reverse transcrip-

group-specific antigen, because the proteins encoded in this

tion takes place in a subviral particle to produce a full-length,

gene are more highly conserved, and therefore more widely

linear dsDNA copy of the RNA. The composition of this sub-

cross-reactive immunologically, than are the envelope pro-

viral particle is not well defined. It certainly contains RT and

teins of the virion. The peptides derived from the Gag poly-

its associated activities as well as components derived from

protein, the precursor polyprotein encoded in the gag gene,

Gag, but which Gag components are present and whether

form the capsid of the retrovirion. The pro gene encodes a

cellular proteins form part of this particle are not known.

protease (PR) that is required for the processing of Gag, and

Reverse transcription begins in the cytoplasm. In most

pol encodes three activities, RT, RNase H, and integrase (IN).

viruses, the full-length dsDNA is produced in the cytoplasm,

RNase H forms a separate domain in the RT-RNase H protein,

but in some the finishing touches occur after transfer to the

but functions as an integral component of RT. IN is required

nucleus. After transfer to the nucleus, the viral DNA is inte-

for the integration of the dsDNA copy of the retroviral genome

grated into the host chromosome, essentially at random, in a

into the host chromosome. The fourth gene, env, encodes the

process that requires the activity of IN. In the simple viruses,

envelope glycoproteins present at the surface of the enveloped

transfer to the nucleus occurs during cell division, when

retrovirion. The primary product is Env, which is processed

the nuclear envelope is disassembled. At least some of the

by cleavage to form an N-terminal external protein called SU

complex retroviruses, however, such as HIV, encode pro-

(for surface) and a C-terminal protein that spans the mem-

teins that allow the DNA-containing complex to traverse the

brane called TM (for transmembrane). The order of genes in

nuclear membrane. Thus, the simple retroviruses can only

the provirus is the same as in the viral genome.

productively infect dividing cells, whereas HIV can infect

As described earlier, the genomes of complex retroviruses

nondividing cells.

contain a number of regulatory genes in addition to these

four basic genes present in all retroviruses. These genes will

be described later.

Synthesis of First DNA Strand

The process of reverse transcription of the viral genome

is illustrated in Fig. 6.3. At the ends of the viral RNA are

U5 PB

leader

U3 R

domains that are essential for production of the dsDNA

copy of the RNA genome. These are illustrated schemati-

cally in Figs. 6.2 and 6.3, and the sizes of these elements are

gag

Genome

pol

env

CAP

shown in Table 6.2 for a number of different retroviruses.

A direct repeat element called R, 15230 nucleotides in

length depending on the virus, is present at the two ends of

the RNA genome. At the 5¢ end of the genome, a unique

Provirus

sequence element called U5 (70220 nt long) is present

LTR

immediately downstream of R, and at the 3¢ end of the

genome a unique element called U3 (2301200 nt) is present

Polymerase Envelope

Capsid

immediately upstream of R. On completion of DNA synthe-

proteins

sis, these elements give rise to direct repeats present at the

ends of the viral DNA, called the long terminal repeats or

Virion

LTRs, which have the sequence U3RU5.

Immediately 3¢ of U5 is a primer binding site (PBS), where

18 nucleotides are exactly complementary to the 3¢ end of a

specific cellular tRNA. Each genomic RNA molecule has

FIGURE 6.2 Diagram showing the overall organization of the genes

bound to it at the PBS one molecule of the appropriate tRNA,

in the retroviral RNA genome, the comparable organization of the DNA

which is used as a primer for DNA synthesis. The tRNA

provirus, and the location of the various virus-encoded proteins in the

mature virion. The RNA strand is shown in green; the DNA provirus is

used depends on the virus, and several different tRNAs are

shown in blue. The ORFs in the genome are color coded to match their

known to be used by different viruses (Table 6.2).

products in the virion. The nontranslated regions of the RNA genome and

Reverse transcription begins by extending the primer

the long terminal repeats (LTRs) are described in detail in the text. The pro

tRNA through U5 and R, and stops when the 5¢ end of the

gene, located between gag and pol, is not shown here. Adapted from Goff

RNA genome is reached (Fig. 6.3, steps 1 and 2). The cDNA

(1997), Figure 3.5 on p. 143.

59 R U5PBS gag pro pol

PPT

1) Primer tRNA anneals to PBS sequence

env

in genome RNA

3' R' U5'

2) tRNA is extended to form DNA copy

of the 5' end of the genomic RNA

Strong Stop DNA

3) RNase removes hybridized RNA

(R and U5)

4) First Jump. DNA hybridizes to

remaining RNA R sequence at 3' end

R' U5'

PPT

U3'

R' U5'

5) DNA minus-strand extended and

completed; most RNA removed.

PPT

6) Plus-strand DNA primes at polypurine

track (PPT) downstream of env gene 5'

end of plus-strand DNA is synthesized

7) RNase H degrades tRNA and PPT

U39

R9 U59

PBS

8) Second Jump Plus-strand DNA binds

U39 R9 U59

U39

R9 U59

to the primer binding sequence (PBS)

near the 3 end of minus-strand DNA

9) Both strands extended and completed

to give double-stranded DNA with

duplicated LTRs in the same orientation

at both ends

PBS

PPT

gag pro pol

env

U3'

R U5

R U59

LTR

FIGURE 6.3 Mechanism of retroviral DNA synthesis (reverse transcription). Green lines are RNA, light blue lines are

minus-strand DNA, and the dark blue line in the last three steps is plus-strand DNA. Features within the LTRs (U3, R,

U5), as well as the PBS and PPT (polypurine tract), are indicated by colored bars beneath the lines designating the nucleic

acids, to clarify what is present at each step. Adapted from Fields et al. (1996) p. 1792; Goff (1997) Figure 3.6 on p. 145;

Coffin et al. (1997) Figure 2 on p. 123.

TABLE 6.2 Terminal Regions of Retrovirus Genomes

Approximate sizes in bases of terminal elements

Genus

Prototype virus

Primer tRNA used

230a

Alpharetrovirus

RSV, ALV

Trp

1200b

Betaretrovirus

MMTV

120

Lys-3

Gammaretrovirus

MLV

450

Pro/Gln

Deltaretrovirus

HTLV-1

350

230

220

Pro

Epsilonretrovirus

WDSV

440

His

Lentivirus

HIV-1

450

100

Lys-1,2,3

Spumavirus

HRSV

910

190

160

Lys-1,2

Includes v-src gene.

U3 contains sag gene.

Source: Adapted from Table 2, page 38, in Coffin et al. (1997).

product, called the first strong stop DNA, is then transferred,

primers. Thus, the enzyme differs from the RNA repli-

while still attached to the primer, from the 5¢ end of the

cases of RNA viruses, which use other mechanisms for the

RNA to the 3¢ end ("first jump," Fig. 6.3, steps 3 and 4). It is

initiation of RNA replication

unknown whether transfer is usually to the 3¢ end of the same

molecule, to the 3¢ end of the second copy of the genome,

Why Is the Genome Diploid?

or randomly to either copy of the RNA in the virus. This

transfer uses the repeat element R at the 5¢ and 3¢ ends--the

Why the retroviral genome is diploid is not clear. In other

DNA copy detaches from R at the 5¢ end and anneals to R at

instances where reverse transcription occurs, such as in the

the 3¢ end, so that only one copy of R is present in the DNA

hepadnaviruses and the retrotransposons, the RNA to be cop-

transcript. RNase H is presumably important for this. During

ied is not diploid. Furthermore, in vitro studies have shown

reverse transcription, the RNA strand is destroyed by RNase

that retroviral RT can use a single copy of the RNA genome

H about 18 nt behind the transcription point. The degrada-

to produce a full-length dsDNA. Thus, two copies of the

tion of the RNA strand during transcription of the DNA copy

genome are not essential. However, it is possible that dur-

may encourage the jump to the other end. Other components

ing infection the process is more efficient if the RT can go

of the particle may also be involved in the jump.

back and forth between the two copies, and this resulted in

After the jump, reverse transcription resumes until the 5¢

selection for a diploid genome in retroviruses. The process of

end of the RNA template is reached. Note that the RNA strand

reverse transcription to produce the viral dsDNA is complex

now ends at PBS because RNase H has degraded the RNA

with the multiple jumps required, and the diploid genome

strand of the DNARNA hybrid (but not the RNA in PBS

could be organized in such a way as to make these jumps

because this is an RNARNA duplex). This process results

more efficient. Other possible advantages of a diploid genome

in the formation of what is called first-strand DNA or minus-

that could have resulted in selective pressure for diploidy are

strand DNA, because it is the antimessage sense (step 5).

the possibility of overcoming at least some damage in the

RNA by switching templates, and the fact that switching tem-

plates results in recombination. Recombination does occur

Synthesis of the Second DNA Strand

frequently in retroviruses, and it is clear from many studies

The first-strand DNA produced in this way is the tem-

that recombination has been important in their evolution.

plate for second-strand (plus-strand) DNA synthesis. The

primer for second-strand synthesis is an RNA oligonucle-

Integration

otide, called the polypurine tract or PPT, positioned imme-

diately 5¢ of U3. PPT survives RNase H degradation and its

After the appearance of the full-length dsDNA genome

3¢ terminus is exact; that is, the cleavages to produce it are

in the nucleus, the viral integrase catalyzes its insertion into

precise (Fig. 6.3, step 6). In addition to this precise primer

a host cell chromosome by means of a single recombina-

for plus-strand synthesis, which defines the boundary of U3

tional event. This process is illustrated in Fig. 6.4. Insertion

and thus of the LTR, additional priming sites are used in

is essentially random within the host genome. The first event

in integration is the removal of two nucleotides from the 3¢

some retroviruses, such as HIV.

The PPT plus-strand primer is extended through U3, R,

end of both strands of the viral DNA. The next two nucle-

otides are always AC, from 3¢ to 5¢. The 3¢ OH of the now

U5, and into the region of the primer tRNA, which is still

3¢-terminal A residue is used to attack an internucleotide

attached to the first-strand DNA. The 18 nucleotides of the

tRNA primer that are complementary to the PBS are copied,

phosphate in the host DNA. Attack is coordinated so that

but further copying is thought to be blocked by a modified

both ends of the viral DNA are inserted at once. The spac-

nucleotide in the tRNA that cannot be copied. The tRNA

ing between the two insertion points depends on the viral

primer is then removed by RNase H (step 7) and a second

integrase and is 4, 5, or 6 nucleotides in different viruses.

jump occurs. In the second jump, the nascent second-strand

The ends of the inserted structure are then cleaned up, prob-

DNA is transferred to the other end of the template, using

ably by host enzymes. Insertion results in the loss of the two

the PBS sequence, which is now present at the 3¢ ends of

terminal nucleotides of the viral DNA. In addition, a duplica-

both strands (second jump, step 8). Synthesis of both strands

tion of the 4, 5, or 6 nucleotides of the host that lie between

of DNA resumes and it becomes full length and double

the two insertion points is produced, and these duplicated

stranded. The resulting dsDNA is cleaned up, probably by

nucleotides flank the two ends of the viral genome.

cellular enzymes. In the full-length, linear ds copy of the

The integrated form of the virus, the provirus, is stable.

genome, the LTR sequence U3RU5 has been formed at

No mechanism for precise excision of the provirus is known,

both ends of the DNA genome (Fig. 6.3, step 9).

and integration is essentially irreversible. Most retroviruses

It is of interest that RT, like DNA polymerases, requires

do not kill the host cell, and the provirus behaves as a simple

a primer to synthesize DNA, but unlike most DNA polymer-

Mendelian gene that is transmitted to all daughter cells. It

ases it can copy either DNA or RNA, given the appropriate

is obvious that insertion of such a provirus into the germ

LTR

R U5

Nucleophilic

attack by water

TGTGGAAAATCTCTAGCAGT

ACTGGAAGGGCTAATTCAC

ACACCTTTTAGAGATCGTCA

TGACCTTCCCGATTAAGTG

Integrase

End processing

Nucleophilic

3' H

attack by water

TGTGGAAAATCTCTAGCA

ACTGGAAGGGCTAATTCAC

ACACCTTTTAGAGATCGTCA

ACCTTCCCGATTAAGTG

Provirus

ACTG

GTCA

X1234Y

Host DNA

Y 4 3 2 1 X

Integrase

Joining reaction

CA1234Y

GTCA

1 2 3 4 X

Cellular enzymes

Repair

Integrated provirus

U3 R U5

X1234TG

CA1234Y

Y 4 3 2 1

4 3 2 1 X

FIGURE 6.4

Steps in the integration of retroviral DNA into the host genome. First, the termini of the blunt-ended

viral DNA are attacked by the integrase, and two bases (blue) adjacent to a highly conserved CA dinucleotide (red) are

lost by nucleophilic attack by a water molecule, leaving recessed 3¢ OH ends. Next, the host DNA is cleaved at the target

sequence and the 3¢ OH ends of the viral DNA are joined by the integrase to the 5¢ phosphates on the host DNA. Overhang

removal and gap and nick repair by cellular enzymes complete the integration reaction. Adapted from Hindmarsh and

Leis (1999); Goff (1997) Figure 3.10 on p. 145, and Coffin et al. (1997) Figure 8 on p. 185.

line would lead to its transfer to progeny organisms, which

polymerase II. The transcription signals, almost all found in

appears to have occurred many times in the past.

U3, include TATA boxes as well as an array of binding sites

for cellular transcription factors that are optimal for the cell in

which the particular retrovirus primarily replicates. Fig. 6.5

Transcription of RNA in Simple Retroviruses

gives examples of the binding sites for transcription factors

The LTR of the integrated provirus has all of the signals

in several different retroviruses. This figure illustrates that

required for transcription of the provirus by cellular RNA

the constellation of binding sites is complex and is different

EFII

EFI

RSV

EFIII

enhancer

TATA

100bp

CBF

bHLH

ELP NF-1 ETs ETs

UCRBP

C/EBP

Factor A

MLV

MCREF

TATA

100bp

PBS

enhancer

promoter

() ()

()

(+)

Myb ETs Sp-1

PTLV-1

NF-1

ETs

Myb

21 bp TREs

TATA

100bp

Sp-1 LBP-1 TAR

NF-κB

NFAT-1 USF-1

COUPTF

HIV-1

AP2

ETs TCF-1

enhancer TATA

100bp

NRE

(+/)

(+)

Oct 1

NF-1

MAF

NBP

MMTV

NF-1

200bp

TATA

NRE

HRE

AP1

HSRV

BREs

200bp

TATA

FIGURE 6.5 Transcription signals in retroviral LTRs. Where the same factor binds to a number of LTRs, the same

symbol has been used. The TRE elements in PTLV-1 are the Tax-responsive elements. The blue arrow marks the

beginning of transcription. Note that the scale of the lower panel is twofold different from that in the upper panel.

Composite of Figures 4, 5, 7, 8, 9, 11 in Chapter 6 of Coffin et al. (1997).

in different viruses that replicate in different tissues. Only

rovirus MasonPfizer monkey virus, this element is called

the upstream (5¢) LTR is used to initiate transcription--or at

the constitutive transport element (CTE). It is 154 nucle-

otides long and is located in the 3¢ nontranslated region of

least efficient transcription.

Transcription initiates precisely at the 5¢ end of R, as

the RNA. In the avian retroviruses, an apparently unrelated

element of about the same size, also present in the 3¢ non-

indicated by the arrow in Fig. 6.5, and proceeds through

the proviral genome and into the 3¢ flanking sequences. The

translated region, provides the same function for unspliced

transcript is capped by host cell capping enzymes. There is

avian retroviral RNA. Interestingly, the avian sequence does

a poly(A) addition signal (AAUAAA) in the RNA, which is

not work in mammalian cells. The monkey virus sequence

usually present about 2030 nucleotides upstream of the end

works in both mammalian and avian cells, but works better

of the viral genomic RNA sequence (i.e., upstream of the 3¢

in mammalian cells. These findings are consistent with the

end of R). Host cell polyadenylation machinery recognizes

hypothesis that these transport elements interact with cellu-

the AAUAAA signal, cleaves the RNA transcript precisely

lar proteins. The inability of unspliced RNA to be exported

at the RU5 boundary, and polyadenylates the RNA. Thus

from the nucleus is one of the reasons that the avian retrovi-

the processed RNA transcript is identical to the genomic

ruses will not replicate in mammalian cells.

RNA and a round-trip from RNA to DNA to RNA has been

made.

Translation of Viral Genomic RNA

In many viruses, the polyadenylation signal is present in

Retroviral genomic RNA is translated into two or three

U3. Thus, there is only one copy of this signal in the RNA

transcript, near the 3¢ end. However, in some viruses the sig-

polyproteins that are eventually processed by the viral

nal is present in R and is therefore present in both the 5¢ and

protease. The order of genes along the genomic RNA is

3¢ regions of the transcript. Interestingly, only the 3¢ copy of

gagpropol, encoding the proteins Gag, Pro, and Pol. Stop

codons are present between Gag and Pro, or between Pro and

the signal is active for cleavage and polyadenylation of the

Pol, or in both places. Termination of the polypeptide chain

transcript.

occurs at these stop codons most of the time during transla-

Some fraction of the genomic RNA is exported to the

tion. These stop codons are suppressed some of the time,

cytoplasm without further processing. There it serves as

however, either by readthrough or by frameshifting (Chapter

mRNA for the synthesis of Gag, GagPro, and/or GagPro

1), so that the amount of Pol produced is usually about 5%

Pol, as described later. Alternatively, it can be packaged

that of Gag. In viruses with one stop codon, the frequency

into progeny viruses. Genomic RNA that serves as mRNA

of suppression is about 5%, but in viruses with two stop

and genomic RNA that serves as the source of RNA for

codons, the frequency of suppression of each stop codon is

packaging are maintained in separate pools.

higher so that significant amounts of Pol are produced even

Some fraction of the genomic RNA is spliced before

though suppression of two stop codons is required. This

export to the cytoplasm. Only one spliced RNA is made in

means that the frequency of suppression is variable and can

the simple retroviruses, which serves as mRNA for Env. In

be controlled by changes in the sequence of the viral RNA.

most retroviruses, the entire GagProPol region is spliced

Because reinitiation does not occur once the chain is termi-

out and the initiation codon for Env is encoded in env. In

nated, the polyproteins produced are Gag and/or GagPro

the avian retroviruses, however, the upstream splice site is

and/or GagProPol, depending on the positions of the stop

located within the Gag coding sequence so that Env begins

codons (Fig. 6.6).

with the first six codons of Gag.

Pro is produced in three different ways in different retro-

The need for both spliced and unspliced versions of the

viruses, as illustrated in Fig. 6.6. In the avian viruses, such

viral RNA means that mechanisms must exist to ensure that

as ALV, there is no stop codon between Gag and Pro so

both are produced and that the ratio of spliced to unspliced

that a GagPro polyprotein is produced. Gag and Pro are

RNA is optimal for virus replication. In the simple retrovi-

thus produced in equal amounts. Frameshifting results in

ruses, the splice sites are suboptimal, so that not all RNA is

the production of a longer polyprotein, GagProPol. Most

spliced. Experiments have shown that the result is an opti-

of the mammalian viruses also only have a single stop

mal ratio of spliced to unspliced RNA. Mutations that make

codon in the ORF, but it is positioned between Gag and

splicing more efficient are deleterious for virus growth and

Pro. Readthrough of a UAG stop codon (murine leukemia

revertants quickly arise that restore the proper ratio. The

viruses) or frameshifting (other mammalian viruses with

second problem faced by these viruses is the need to export

a single stop codon) results in the longer polyprotein. The

unspliced RNA to the cytoplasm. Eukaryotic cells have

two polyproteins produced are Gag and GagProPol, and

control mechanisms to ensure that RNA containing splice

Pro and Pol are produced in the same low amounts. Finally,

sites is not exported from the nucleus. It has been found

several mammalian retroviruses, for example, MMTV and

that sequence elements in the unspliced RNA are required

PTLV-1, have two stop codons in the ORF, both of which

for its export, and it is assumed that these elements interact

can be suppressed by frameshifting. Thus, three polyproteins

with cellular proteins that promote export. In the simian ret-

GAG

PRO

POL

Alpharetrovirus (ALV)

NC Pro

Pr76 gag-pro

p95 (β)

Pr180 gag-pro-pol

(5%)

Gammaretrovirus (MLV)

Pr65 gag

Pr180 gag-pro-pol

(5%)

Betaretrovirus (MMTV)

Pr77 gag

Pr110 gag-pro

Pr160 gag-pro-pol

(25%)

(10%)

Deltaretrovirus (PTLV-1)

Pr55 gag

Pr70 gag-pro

Pr165 gag-pro-pol

Epsilonretrovirus (WDSV)

Pr gag

Pr gag-pro-pol

Lentivirus (HIV)

Pr55 gag

p66

Pr165 gag-pro-pol

(10%)

Spumavirus (HSRV)

Pr78 gag

Pr125 pro-pol

Pro Protease

RT Reverse transcriptase

Frameshift

DU UTPase

IN Integrase

Readthrough

RNase H (where known)

FIGURE 6.6 Organization of the gag, pro, and pol genes of representative retroviruses belonging to each genus. In

some cases two frameshifts are required to generate a complete GagProPol precursor. The gag proteins are illustrated

in more detail in Fig. 6.7. This figure is a composite of Goff (1997) Figure 3.16 on p. 157; and Coffin et al. (1997) pp. 45,

269, 795, and 799. Virus name abbreviations can be found in Table 6.1.

are produced, Gag, GagPro, and GagProPol. In this case

site. Because the monomer is not active, there is a delay in

Pro is produced at intermediate levels.

processing. The high concentration of viral polyproteins that

Processing of these various polyproteins occurs during

occurs in viral particles or in previral particles is required to

assembly of progeny virions. The viral Pro is an aspartate

achieve efficient dimerization of the protease and its activa-

protease whose active site contains two aspartic acid residues

tion. Experiments have shown that premature activation of

(Chapter 1). The protease domain is functional in polypep-

the protease, which can be achieved by using genetic tricks,

tides containing the Pro sequence as well as after its release

is deleterious for virus assembly. Thus, it is important that

by proteolysis as a small protein of about 100 residues. The

processing be delayed until assembly begins or is completed.

enzyme is active only as a homodimer, with each chain in

During processing of Gag, several different proteins are

the dimer supplying one of the aspartic acids in the active

produced, some of which are quite small, whereas others are

a homodimer of RT. In other viruses, cleavage between RT

larger. The proteins produced from Gag are illustrated sche-

and IN is incomplete, and the active enzyme is a heterodimer

matically in Fig. 6.7 for a number of retroviruses. Gag is

of RT and RT-IN. A third pattern occurs in HIV, in which

cleaved to produce at least three protein products in all ret-

partial cleavage occurs between the polymerase domain and

roviruses except the spumaviruses, called MA (membrane-

the RNase H domain. In this case, the products of Pol are a

associated or matrix protein), CA (capsid protein), and NC

truncated RT lacking the RNase H domain (called p51), the

(nucleocapsid protein). These three peptides are always

full-length RT (called p66), and IN. The active reverse tran-

present in that order from the N terminus to the C terminus

scriptase is a heterodimer between p51 and p66.

in the Gag polyprotein. Gag (and thus MA) is myristoylated

in most retroviruses and associates with membranes.

Myristoylation may serve to recruit Gag to membranes for

Production and Processing of Env

assembly or budding. NC is a small basic protein that binds

RNA and Zn2+. It has a number of functions, including bind-

Translation of the mRNA for Env produces the envelope

ing to the packaging signals in the viral RNA that lead to

glycoprotein precursor. Processing of Env and the location

its incorporation into virions, the facilitation of binding of

of key features are illustrated in Fig. 6.8 for a number of ret-

the tRNA primer to the genomic RNA, the formation of

roviruses. The precursor has an N-terminal signal sequence

the genomic RNA dimer, and strand transfer during reverse

(labeled L in the figure), which leads to its insertion into

transcription. CA is a larger protein that is believed to form

the endoplasmic reticulum, a membrane anchor sequence

a shell around the viral RNA and its associated internal pro-

near the C terminus, and a C-terminal cytoplasmic domain

teins (Fig. 2.21). In addition to these three proteins, in most

(i.e., the protein is a type I integral membrane protein). The

retroviruses other proteins, whose functions are not well

signal sequence is removed during translocation into the

understood, are also produced from Gag (Fig. 6.7).

endoplasmic reticulum, and the protein is glycosylated and

Processing of Pol varies in different viruses. Three pat-

transported to the plasma membrane by conventional cel-

terns of cleavage can be distinguished. In some viruses,

lular pathways. As with many other viral glycoproteins, the

RT, consisting of the polymerase domain and the RNase H

precursor is cleaved by furin during transport to produce an

domain, is released from the upstream Pro and the down-

N-terminal extracellular component called SU (for surface)

stream IN. The active reverse transcriptase is a monomer or

and a C-terminal membrane-spanning component TM (for

CA (capsid)

NC (nucleocapsid)

MA (matrix)

99Minimum99

GAG

ALV

p12

p19

p27

p10

MLV

p15

p12

p30

p10

MMTV

p10

p27

p21

p3 p8?

p14

PTLV-1

p24

p15

p19

WDSV

p10

p25

p14

p20

(p10)

HIV-1

p24

p17

HSRV

(CA)

(MA)

(NC)

Myristate

Acetate

FIGURE 6.7 Organization of the Gag proteins in representatives of each retroviral genus. The viruses are shown in the

same order as those in Fig. 6.6. Vertical solid lines mark sites of cleavage by the viral protease. Sequences representing

the mature matrix, capsid, and nucleocapsid proteins are indicated with different shadings, and the approximate molecular

weights of the processed proteins are shown. Note that the Gag polyprotein of HSRV is not processed. From Coffin et

al. (1997) pp. 44 and 798.

ALV

gp85

gp37

MLV

p15E/12E

gp70

MMTV

gp52

gp36

PTLV-1

gp46

gp21

WDSV

gp90

HIV

gp120

gp41

HSRV

gp80

gp48

Fusion domain

SU protein

Signalase

Pro (viral protease)

Transmembrane

TM protein

Furin

N-linked carbohydrate

anchor

FIGURE 6.8 Organization of the envelope proteins of representatives of each genus of retroviruses, shown in the

same order as in Figs. 6.6 and 6.7. The domains corresponding to the mature SU and TM proteins are shown in different

shades of color. Cleavages by signalase to remove the leader peptide (L) are indicated with white arrows, and those due

to furin by yellow arrows. The red arrow marks the site of cleavage in MLV by the viral protease. The fusion domains,

the transmembrane domains, and the sites of predicted N-linked carbohydrate addition are shown. Adapted from Coffin

et al. (1997) Figure 10 on p. 56. Virus name abbreviations can be found in Table 6.1.

transmembrane). SU and TM remain associated. In some

The accessory genes of the complex retroviruses are

cases, the association is stabilized by disulfide bonds, but

located upstream or downstream of env and are translated

in other cases there is no covalent linkage. SU is always

from spliced mRNAs, with some of the genes requiring

glycosylated, whereas TM may or may not be glycosylated.

multiple splicing for expression. The genome organizations

Cleavage to produce SU and TM is required for the activation

of the different genera are diagrammed in Fig. 6.9 to show

of the fusion activity, which is located near the N terminus

the location of these accessory genes. The different acces-

of TM. Thus, the production of the envelope glycopro-

sory genes have been inserted into the retroviral genome at

teins of the retroviruses parallels that of the envelope gly-

different times during the evolution of these viruses (Fig.

coproteins of many enveloped RNA viruses.

6.1), and insertion of such genes appears to be a dynamic

process that is ongoing. As one example, the vpx gene of

HIV-2 and the vpr gene of HIV-1 appear to have been

Accessory Genes of Complex Retroviruses

inserted into their respective viruses after the separation of

In addition to the core genes gag, pro, pol, and env that

HIV-1 and HIV-2.

are present in all retroviruses, members of the four genera of

The presence of the accessory genes allows more vigor-

complex retroviruses possess additional genes that allow them

ous replication of the retrovirus that possesses them, which

to regulate the development of the infection cycle. Accessory

can be fatal to the host cell. As described before, the simple

genes are also present in the betaretroviruses, but these are

retroviruses do not kill the host cell, but instead establish a

not regulatory in nature. A listing of the accessory genes in

persistent infection in which the cell survives and produces

different retroviruses is given in Table 6.3, and a complete

low levels of virus indefinitely. However, at least some of

listing of all of the proteins of HIV is shown in Table 6.4.

the complex retroviruses, such as HIV-1, can replicate to

TABLE 6.3 Accessory Genes in Retroviruses

(2) activation of transcription of the provirus to greatly

increase the rate of production of viral RNA; (3) export of

Gene

Functions

unspliced viral RNA to the cytoplasm; (4) arrest of the cell

cycle in infected T cells; (5) promotion of virus assem-

Betaretrovirus (MMTV)

bly and release; and (6) protection from cellular defense

sag

Superantigen

mechanisms.

dut

dUTPase

Deltaretrovirus (HTLV/BLV)

Transport of Viral DNA into the Nucleus

tax

Transcription activator (like tat)

rex

Splicing/RNA transport regulator (like rev)

HIV-1, and probably other lentiviruses as well, can infect

Lentivirus (HIV-1)

quiescent cells because the viral DNA and associated pro-

tat

Transcription activator (like tax)

teins can cross the nuclear membrane. The product of the vpr

rev

Splicing/RNA transport regulator (like rex)

gene appears to be required for this. MA and IN have also

been implicated in the process.

vif

vpr/vpx

See Table 6.4

nef

Transactivation of the Transcription of Viral RNA

vpu

All complex retroviruses encode a protein that transacti-

dut

dUTPase (in nonprimate lentiviruses)

vates transcription of viral RNA from the provirus. In PTLV/

Facilitates replication in certain cell types.

BLV, the gene for this protein is called tax. The Tax protein

Spumavirus (HSRV)

activates transcription by means of sequence elements in the

tas (bel 1)

Transcription activator (DNA binding protein)

U3 region of the viral DNA called Tax-responsive elements

bel 2

(TREs), whose locations are shown in Fig. 6.5. Tax interacts

bet

? (may be involved in latency)

with cellular transcription factors that bind to TREs, and this

Epsilonretrovirus (WDSV)

interaction results in increased activity of the transcription

factors. One such transcription factor is the cAMP response

Orf A

Viral homologue of cyclin D

element/activating transcription factor (CREB/ATF). Tax

Orf B

also increases the transcription of certain cellular genes, in

Orf C

some cases through its interactions with CREB/ATF, and in

other cases by stimulating the transcription of genes regu-

Source: Adapted from Coffin et al. (1997) Table 1 on p. 36, and

lated by NFκB. Many of these cellular genes are important

information from Fauquet et al. (2005).

in the regulation of T cells, and their stimulation may relate

high titer in some cell types with the result that the cells

to the pathology of disease caused by the virus.

die. It is interesting that many endogenous retroviruses

In the lentiviruses, the gene for the transcriptional acti-

are present in the germ line of different vertebrates, as

vation is called tat. The Tat protein works in one of two

described later. However, none of these are complex ret-

different ways. Tat of visna virus appears to interact with

roviruses. It is possible that the regulated lifestyle of the

cellular transcription factors in a manner similar to Tax,

complex viruses would make complex endogenous viruses

using a sequence element in U3, although the cellular fac-

difficult to silence. The inability to silence such viruses

tors are different. Tat of HIV and its close relatives, how-

could lead to selection against organisms that contain them

ever, stimulates transcription by binding to a sequence

in the germ line.

element called TAR at the 5¢ end of the viral RNA. TAR is

Many of these proteins encoded by the accessory genes

composed of the first 60 nucleotides of HIV-1 RNA, which

are multifunctional and their functions are only partially

form a stem-loop structure that is essential for the function

understood. The intense interest in PTLV and HIV has

of TAR. TAR of both HIV-1 and HIV-2 are shown in Fig.

resulted in extensive study of their accessory genes, tax

6.10. How the binding of Tat to TAR activates transcrip-

and rex in the case of PTLV/BLV and tat, rev, vif, vpr/

tion is not yet clear. One model is that Tat interacts not

vpx, nef, and vpu in the case of lentiviruses. The acces-

only with the nascent viral RNA but also with cellular tran-

sory genes of the spumaviruses, bell, bel2, and bet, as well

scription factors, and in so doing stabilizes the transcrip-

as those of the epsilonretroviruses, have been less well

tion complex or changes its composition. In this model, the

studied. The functions of these genes can be conveniently

altered transcription complex is more processive, allow-

grouped into six categories: (1) transport across the nuclear

ing the production of complete RNA genomes rather than

membrane of subviral particles that synthesize viral DNA

truncated transcripts. It may also initiate transcription more

after infection, allowing the virus to infect quiescent cells;

frequently.

TABLE 6.4 The HIV Proteins

Protein

mRNA

Size (kD)

Post-translational modifications

Functions

gag

Genomic RNA

p25 (CA)

None

Capsid structural protein

p17 (MA)

Myristoylated at Gly-2

Matrix protein

RNA-binding protein

pro

Genome RNA

p10 (PR)

Viral protease, processes gag proteins

frameshifted

pol

Genome RNA

p66/p51 RT

Heterodimer, p51 lacks RNase

Reverse transcriptase

frameshifted

H domain present in p66

vif

vif mRNA

p23

Viral infectivity factor, essential for spread in macrophages

vpr/vpx mRNAa

vpr/vpx

p15

Associates with p7

Augments replication

tat

tat mRNA

p14

Required for replication transactivates RNA synthesis,

binds to TAR RNA

rev

rev mRNA

p19

Regulates splicing/RNA transport; binds RRE element and

facilitates env translation

vpu

vpu/env mRNA

p16

Phosphorylated on Ser

Helps in virion assembly and release, dissociates gp

160/CD4 complex

env

vpu/env mRNA

gp 120 (SU)

24 sites for N-linked glycosylation

Surface glycoprotein, mediates cellular attachment

gp 41 (TM)

7 sites of N-linked glycosylation

Transmembrane glycoprotein

nef

nef mRNA

p27

Myristoylated at Gly-2,

Homodimer, causes pleiotropic effects, including

phosphorylated at Tyr-15

downregulation of CD4

vpr is found in HIV-1; vpx is found in HIV-2.

Source: Adapted from Levy (1994) Table 1.4, p. 8.

Export of Unspliced Viral RNA to the Cytoplasm

lular proteins involved with the nuclear export pathway.

Complex retroviruses encode proteins that promote

The end result is that Rev promotes the export of RNAs

the export of unspliced or partially spliced RNA from the

containing RRE (i.e., unspliced genomic RNA and singly

nucleus. The proteins are Rex in the case of PTLV/BLV and

spliced mRNAs) from the nucleus to the cytoplasm (Fig.

Rev in the case of lentiviruses. Rex and Rev are translated

6.12). Rev appears to accompany the RNA to the cyto-

from multiply spliced mRNAs, as are the transcriptional acti-

plasm and then to cycle back to the nucleus. Thus, after the

vators and Nef in the case of the lentiviruses. The multiple

appearance of Rev, the infection cycle switches to a late

splicing events in HIV-1 are illustrated in Fig. 6.11. Early

phase with the appearance in the cytoplasm of the mRNAs

in infection, before Rex (PTLV/BLV) or Rev (HIV-1, -2)

for GagProPol, Env, Vpu, Vif, and Vpr. Genomic RNA

are present, only completely spliced mRNAs are exported

exported to the cytoplasm can also be packaged into

from the nucleus to the cytoplasm. Thus, the proteins made

progeny virions.

early are the transcriptional activators, Nef, and the proteins

In addition to its function in the export of viral RNAs

that control the export of unspliced or partially spliced viral

to the cytoplasm, Rev also has other functions. These func-

RNAs from the nucleus. The transcriptional activators accel-

tions appear to include regulation of the splicing of HIV

erate the production of viral RNAs, and Rex and Rev allow

RNAs and increasing the efficiency of translation of HIV

the export of mRNAs for the other viral proteins, which

RNAs (Fig. 6.12).

includes the genomic RNA. These processes are illustrated

The PTLV Rex appears to function similarly to Rev. It

schematically in Fig. 6.12.

binds to an RNA element, called the RexRE, that is similar

Studies with HIV-1 have shown that Rev binds to a

in size to the RRE, and binding of Rex promotes export of

sequence element in the viral RNA called the Rev response

viral RNA from the nucleus. However, the RexRE is found

element or RRE. HIV-1 RRE is 234 nucleotides in size and

in the U3R region of the genome and is therefore present

has multiple stem-loop structures that are important for

in all of the viral mRNAs. It is curious that Rex binds HIV-1

function. It is found in the env gene region and is therefore

RNA, although not in the same place as Rev, and will sub-

spliced out of the multiply spliced mRNAs (Fig. 6.11). In

stitute for Rev in HIV-1. However, Rev does not bind PTLV

addition to binding to RRE, Rev also interacts with cel-

RNA and will not substitute for Rex.

Alpharetrovirus

ALV

Gammaretrovirus

MLV

Betaretrovirus

MMTV

orf

Deltaretrovirus

PTLV

tax

rex

Epsilonretrovirus

WDSV

Lentivirus

HIV

vif

vpr

nef

tat

rev

vpu

Spumavirus

HSRV

bel1 bel3

bel2

bet10kb

GAG

POL

U3 U5

LTR

ENV

PRO

FIGURE 6.9 Coding regions of representatives of each retrovirus genus. Sites of translation initiation are shown with

arrows. The locations of the four major genes are shown in different colors. Accessory genes are named. Redrawn from

Coffin et al. (1997) Figure 5 on p. 37, and from Fields et al. (1996) p. 1776.

Cell Cycle Arrest in T Cells

interact with Gag. They are found in the virion in amounts

similar to that of Gag. Vif is a membrane-associated protein

HIV-1 kills infected T cells during active replication by

that is also present in the virion, but in amounts similar to

arresting the cell cycle. Cell death results from necrosis,

Pol rather than Gag. It has an effect on the processing of

not apoptosis as in the case for many viruses. The result in

Gag and is required for the production of infectious virions

infected humans is the depletion of T cells and, ultimately,

as described later. Nef, found in the primate lentiviruses,

progression to AIDS. The products of the vif and vpr genes

is a multifunctional protein that has a role in the assem-

are required for this arrest. Elimination of both genes, but

bly and release of infectious virus. Myristoylated forms

not of either one separately, results in a virus that cannot

of Nef are associated with the virion, where they may be

cause cell cycle arrest.

required for full infectivity of the virion. Another function

of Nef is the removal of CD4, the receptor for HIV, from

the surface of the infected cell. Removal of CD4 prevents

Assembly Functions

the interaction of Env with CD4 and facilitates the assem-

Several accessory proteins of the lentiviruses promote

bly and release of viruses. It also prevents superinfection of

the assembly and release of infectious virus, either directly

the cell by released virus. Vpu, a small integral membrane

or indirectly. Vpr, found in most lentiviruses, including

protein found in HIV-1 but not in HIV-2, promotes virus

HIV-1, and Vpx, found in HIV-2, are structural proteins that

release in two ways. It promotes the degradation of CD4 by

U G

G U

U A CU

U G

A A

20 GG CA

A U

G C

A U

100

G C 90

CCAG CAC U G

10 U

C GGGUCGUGGC C

10 G C 110

U A

C G

U A

G C

C G

U G 120

1 G

G C

130

ACUGCUUA. . .

1 G C

CACGCUUGCUUGCUU. . .

HIV-1 TAR

HIV-2 TAR

FIGURE 6.10 Structures of HIV-1 and HIV-2 TAR RNA elements. Nucleotides are numbered from the 5¢ end of the

RNA. For HIV-1, positions involved in binding to Tat protein (yellow oval) are circled, and the bases involved in tertiary

structure alterations following Tat binding are shown in red. Less is known about the HIV-2 Tat binding. Adapted from

Coffin et al. (1997) Figure 12 on p. 226.

LTR

Proviral DNA

tat

rev

vpu

nef

Frame 3

pro

vpr

Frame 2

ORFs

env

pol

Frame 1

gag

vif

rev

tat

RRE

TAR

Genomic RNA

(gag mRNA) CAP

(gag-pro-pol mRNA)

Other mRNAs

vif mRNA CAP

vpr mRNA CAP

tat mRNA CAP

rev mRNA CAP

vpu, env mRNA CAP

nef mRNA CAP

FIGURE 6.11 Genome organization and transcription map of HIV-1, the human immunodeficiency virus. The genome

is shown on the top line as the integrated provirus. The LTRs and all open reading frames (ORFs) are indicated. Below

this, the unspliced genome RNA is shown, with TAR and RRE (the Rev response element in env) indicated. The various

spliced mRNAs (and the ORFs translated from them) are diagrammed below the RNA genome. The pale blue shading

indicates the location of the RRE, which is spliced out of tat, rev, and nef messages. Redrawn from Coffin et al. (1997)

p. 803.

EUKARYOTIC HOST CELL

NUCLEUS

Integrated provirus

of complex

retrovirus

RRE

Early events

Late events

(minus REV)

(plus REV)

Spliceosome

+ Rev oligomer

+RAB

Further

splicing

Export of

non- and singly spliced mRNAs

multiply spliced mRNAs

Translation

Rev, Nef, Tat

Gag, Pro, Pol, Env, and other proteins

REV response element (RRE)

Components of spliceosome

Rev oligomer

RAB (similar to nucleoporins)

FIGURE 6.12

Model of Rev action. Rev is thought to (A) Mediate export of nonspliced or singly spliced RRE-

containing RNAs from the nucleus; (B) Inhibit complete splicing of mRNA; (C) Enhance translation of unspliced and

singly spliced mRNAs. Adapted from Coffin et al. (1997) p. 244.

a mechanism different from that used by Nef. It also facili-

recruits ubiquitin ligases such that hA3G is degraded by the

tates the release of budding virus from the cell, a function

proteasome, thereby preventing it from being incorporated

fulfilled by Env in HIV-2.

into virions.

Vif Abrogates a Cell Defense Mechanism

The dUTPase Gene

Vif, so named because it serves as a viral infectivity fac-

The nonprimate lentiviruses and members of the betaret-

tor, is required for the production of infectious virus in cer-

roviruses contain a gene encoding dUTPase, called dut. This

tain cell types, such as primary CD4 T lymphocytes. These

gene was acquired independently by these two different

cells produce a protein called hA3G or APOBEC3G, which

lineages (Fig. 6.1). The enzyme dephosphorylates dUTP,

deaminates cytosine. This protein is incorporated into prog-

thereby preventing its incorporation into DNA. A cellular

eny virus in the absence of Vif, rendering the virions nonin-

gene usually provides this function for retroviruses (and

fectious because during first-strand DNA synthesis 10% or

for DNA viruses). However, possession of this gene allows

more of cytosines can be deaminated. This results in hyper-

these two genera of retroviruses to replicate in quiescent

mutation of G to A in the plus-sense second-strand DNA,

cells that do not express adequate levels of the enzyme, such

making the provirus nonfunctional. Vif binds to hA3G and

as macrophages.

it is free to diffuse whereas cellular proteins are not, can-

Assembly of Retroviruses

not be excluded. SU/TM is not required for virus assembly.

The retrovirus virion is approximately 100 nm in diam-

Glycoproteins from other viruses can substitute for SU/TM.

eter and acquires its lipid envelope by budding through the

More strikingly, capsids can bud to form noninfectious bald

plasma membrane of the infected cell. Two forms of budding

particles free of glycoprotein. In a key experiment, it has

occur, as illustrated in Fig. 2.21. In the betaretroviruses and

been found that HIV-1 buds from the basolateral surface of

the spumaviruses, the capsid is assembled in the cell cyto-

polarized cells, where SU/TM is found. However, when SU/

plasm and then buds through the plasma membrane. In the

TM is absent, Gag-directed budding occurs from both baso-

alpharetroviruses, the gammaretroviruses, and the lentivi-

lateral and apical surfaces. This result provides evidence that

ruses, the capsid assembles during budding and is not visible

specific interactions between the capsid and the glycopro-

as a distinct structure within the cell. MasonPfizer monkey

teins occur during virus budding and are important, but these

virus, a betaretrovirus, changes from budding of preassem-

interactions are not essential for budding to occur.

bled capsids to assembly of capsids during budding as the

result of a single amino acid change in MA. Thus, the dis-

Alpharetroviruses and Gammaretroviruses

tinction between the two types of budding does not represent

a fundamental difference in budding pathway but simply a

Alpharetroviruses

matter of the stability of the capsid in the absence of interac-

The alpharetroviruses comprise a large collection of

tions with other components of the virion during budding.

avian leukosis and sarcoma viruses. Dozens of ALVs are

The capsid is formed by the assembly of Gag, GagPro, and/

known. They are grouped into seven interference groups,

or GagProPol polyproteins into a structure having spherical

AG, in which members of a group use the same receptor.

symmetry. RNA appears to be required for assembly but not

Infected cells cannot be superinfected by another member

the Env protein, even in viruses whose capsids assemble dur-

of the same interference group, because the receptors for it

ing budding. These polyproteins are incorporated into the cap-

have been eliminated. Expression of the viral envelope pro-

sid in approximately the same ratio as they are produced inside

tein is usually responsible for the downregulation of recep-

the cell. During or after budding, the viral protease cleaves the

tors, which is important for the budding and release of virus.

polyprotein precursors to the final products. These cleavages

It also prevents the cell from becoming infected by hundreds

are required for the virus to be infectious and result in a change

or thousands of progeny viruses. This may be important for

in the structure of the capsid. The final, fully cleaved virion

the survival of the infected cell and may allow it to produce

may have the capsid centrally placed within it or it may be

progeny viruses indefinitely.

eccentrically placed, and the shape of the capsid may be spher-

Interference groups A, B, C, and D of the ALVs are exog-

ical or it may have other shapes, depending on the virus (Fig.

enous viruses that are transmitted as infectious agents from

2.21). As described before, it is important that the cleavages be

chicken to chicken. Members of group E are endogenous

delayed until the virion is partially or completely assembled, or

viruses, resident in the germ line of the chicken. The endog-

the assembly process will not work properly.

enous viruses may be quiescent and not expressed, or parts

During assembly, the genomic RNA is recruited into the

of the provirus genome or even the entire genome may be

‡psid and dimerized. There is a packaging signal in the

RNA, usually referred to as ψ, that is often found in the 5¢

expressed. In the latter case, progeny viruses are formed that

can infect other cells, leading to widespread expression of

region downstream of the LTR. The signal is not present in

the virus in the animal. The endogenous viruses of chick-

the spliced RNAs of many retroviruses but even in those in

ens, as well as those of mammals, tend not to be expressed.

which it is present, the spliced RNAs are not packaged. The

Expression often results in disease and a shortened life span,

packaging signal is not absolutely required for packaging,

and the animals are selected to not express integrated provi-

but increases the efficiency of incorporation into the virion

ruses. In chickens, the level of expression and the time in the

by about 100-fold. Because Gag is the only protein required

animal's life when expression of an endogenous virus occurs

for assembly of capsids, the recognition of the packaging

is different for different strains of chickens.

signal must be a property of Gag. During maturation of the

ALVs are commonly present as infectious agents in

virion, the RNA dimer also matures from a less stable form

chicken flocks around the world. The major illness caused

to a more stable form. tRNA is recruited into the capsid by

by these viruses is a wasting disease characterized by ane-

RT, but association with RT is not absolutely required for

mia, immunosuppression, and poor growth. Perhaps of more

packaging of the primer tRNA.

interest to the molecular biologist, these viruses may also

The envelope glycoproteins, SU and its associated TM,

cause leukemia or sarcoma, as described later.

are incorporated into the virion during budding. The mecha-

Interference groups F and G are viruses of pheasants.

nism by which SU/TM is recruited is uncertain. Evidence

These viruses have not been as well studied as the viruses

indicates that MA interacts with TM, but a model in which

of chickens.

SU/TM is incorporated nonspecifically, perhaps because

Gammaretroviruses

gene under the control of the strong viral promoters, and

the resulting overexpression of the oncogene may result in

The gammaretroviruses consist of a large number of leuke-

a tumor cell. In the case of bursal lymphomas induced by

mia and sarcoma viruses of mice, cats, primates, and other

infection of chickens by ALV, for example, it has been found

mammals. Also included in the genus is reticuloendotheliosis

that more than 80% of tumors have ALV provirus inserted

virus of birds, which causes immunodeficiency. The murine

near the c-myc gene and overexpress the c-myc product. In

leukemia viruses have been particularly well studied. Both

other cases, insertion of the provirus within the oncogene

exogenous viruses and endogenous viruses of mice are known.

may result in the expression of an mRNA that lacks control

The mouse genome contains 5001000 endogenous proviruses

sequences (such as sequences that cause the mRNA to be

that are divided into four classes, but only two of these classes

degraded rapidly) or that is translated into an altered protein

are known to encode infectious viruses. One class encodes

product that has lost regulatory elements. Such a process is

betaretroviruses, described later, and the other class consists of

often seen in erythroblastosis induced by ALV in chickens,

50 to 60 copies of gammaretroviruses. The host range of mouse

for example. Integration of the provirus between two exons

endogenous gammaretroviruses depends on the env gene. These

of c-erbB separates the domain of the protein that binds

viruses may be ecotropic (able to infect only mice), xenotropic

epidermal growth factor and tumor growth factor from the

(unable to infect mice but able to infect other animals, such as

domain that leads to downstream signaling by means of pro-

rats), or polytropic (able to infect both mice and other animals).

tein tyrosine kinase activity. Unregulated signaling by the

The endogenous viruses are usually transcriptionally silent, but

modified protein product results in deregulation of growth.

expression does occur in some mouse strains. In an extreme

A different mechanism of tumor induction is often seen

example, AKR mice usually become viremic at an early age

in mice infected by MLV. Most AKR mice spontaneously

and most of the animals eventually die of leukemia.

express an endogenous virus called AKV1 from birth, and die

Feline leukemia virus (FeLV) is an important pathogen of

of thymic lymphomas in their first year of life. For the tumors

cats. It is an exogenous virus that causes T-cell lymphomas

to develop, multiple recombination events between AKV1

and immunodeficiencies, as well as severe aplastic anemia,

and other endogenous viruses are required to produce an Env

in cats. Sarcoma strains of FeLV are also known. A vaccine

protein with altered host range. The altered SU may stimulate

against FeLV that is given to pet cats is partially effective in

T-cell proliferation by binding the interleukin-2 (IL-2) recep-

preventing FeLV-induced disease.

tor, and other altered interactions with T cells and their pre-

Gammaretroviruses of other mammals, including pri-

cursors may also be important in tumor induction. Alterations

mates, are also known, as are sarcoma viruses derived from

in Env are also found in tumors induced by FeLV.

them. Interestingly, however, no gammaretrovirus is known

It is obvious from this description that the properties of

that infects humans, although the human genome does con-

the virus (host range, the nature of the LTR promoters) as

tain many retroviral-like elements.

well as the properties of the host cell are important in deter-

mining whether a tumor will arise. Thus, different strains

Induction of Leukemia by Alpha-

of the same virus may have different effects upon infection

and Gammaretroviruses

of the same host, or one strain of virus may affect different

strains of its hosts differently.

Alpharetroviruses and gammaretroviruses are important

causes of cancer in chickens, mice, cats, and subhuman pri-

mates. The cancers are usually forms of leukemia or lym-

Alpha- and Gammaretroviruses That

phoma, and arise only after a long latent period. The tumor

Express Oncogenes

cells are usually clonal, having developed from a single pro-

genitor tumor cell. Not all infected animals develop cancer.

Alpha- and gammaretroviruses undergo recombina-

Infection by these retroviruses does not directly produce

tion with cellular oncogenes to produce viruses capable of

tumors. Instead, rare insertional or recombinational events

causing tumors in their hosts. Recombination is thought to

must occur that give rise to a tumor cell. Although these

occur during reverse transcription of a hybrid genome in

events are rare, the very large number of cells infected during

which a host mRNA replaces one copy of the viral RNA.

the persistent infection established by the virus may render

Recombinant viruses that express a variety of oncogenes

such events probable, and after a sufficiently long latent

have been repeatedly isolated from spontaneous tumors in

period the probability that a tumor will arise may be high.

animals that are infected by leukosis/leukemia viruses. Such

It is only recently that the mechanisms by which unmodi-

retroviruses will usually transform cells in culture and rap-

fied alpha- and gammaretroviruses induce tumors have

idly cause tumors when inoculated into a new host. Many of

become at least partially understood. One mechanism

these viruses cause sarcomas and the oncogene-containing

involves the insertion of the provirus near to or within a

virus is then referred to as a sarcoma virus. Examples of

cellular oncogene. This may bring the expression of the

the genomes of four oncogene-containing retroviruses are

shown in Fig. 6.13. Two are derived from avian leukosis

in chickens and transforms cells in culture. The transforming

viruses and two from murine leukemia viruses. These exam-

ability is due to the expression by the virus of the oncogene

ples have been chosen to illustrate a range of possibilities

referred to as src. Many isolates of RSV have been made

for the incorporation and expression of the oncogene in the

over the years, and by definition all such viruses express src.

transforming virus genome.

However, the v-src expressed by the different isolates dif-

Most transforming retroviruses are defective, because the

fer because the recombination points are different, and the

oncogene replaces part of the retrovirus genome. However,

v-src genes usually have mutations that distinguish them

some isolates of Rous sarcoma virus (RSV) are nondefec-

from the cellular gene. Most RSVs are defective because the

tive. In this case, the v-src gene is present in the 3¢ region of

recombination event results in the replacement of parts of

the genome and is translated from an independent, spliced

the viral genome by the cellular oncogene, although nonde-

mRNA. Such a nondefective RSV is illustrated in the figure.

fective RSVs have also been isolated as shown in Fig. 6.13.

Also illustrated is an example of avian myeloblastosis virus,

In the case of defective RSVs, or of other defective onco-

which expresses the v-myb gene. This virus is defective

gene-containing retroviruses, a replication competent ALV,

because the v-myb gene replaces most of the env gene of the

or its equivalent for other retroviruses, is required to sup-

virus. It is translated as a v-myb-env fusion protein from the

ply the missing functions if progeny virions containing the

spliced mRNA that would express the Env protein in ALV.

oncogene are to be produced. However, a defective onco-

The Abelson murine leukemia virus expresses v-abl.

gene-containing virion, once formed, is capable of infecting

This gene replaces the pro and pol genes and part of gag in

a cell, making cDNA, and integrating the proviral DNA into

the example shown, and the virus is defective. In this case,

the host genome without help. Subsequent expression of the

Abl is produced as a fusion protein linked to the N-terminal

oncogene under the control of the viral LTRs leads to trans-

domain of Gag. Moloney murine sarcoma virus expresses v-

formation of the infected cell.

mos. In the example shown, v-mos replaces env and is trans-

Since the discovery of RSV, many different oncogene-

lated from a spliced mRNA normally used to express Env.

expressing retroviruses have been isolated, primarily from

RSV, named for its discoverer Peyton Rous, was one of the

chickens, mice, and cats. The identification and study of

earliest such retroviruses discovered. RSV causes sarcomas

oncogenes has resulted in the discovery of many proteins

v-onc-containing Retroviral Genome

Retrovirus

Alpharetrovirus

Avian leukosis virus

Rous sarcoma virus (nondefective)

gag-pro

pol

env

src

gag-pro

pol

env

p60 src

Avian myeloblastosis virus (defective)

Ćenv

v-myb

gag-pro

pol

myb-Ćenv

Gammaretrovirus

Murine leukemia virus

Abelson murine leukemia virus (defective)

Ćgag

Ćenv

v-abl

gag-pro-pol

env

Ćgag-abl

Moloney murine sarcoma virus (defective)

gag

v-mos

mos

FIGURE 6.13 Representative v-onc-containing retroviral genomes and the nondefective retroviruses from which they

were derived by capture of cellular oncogenes. In each case the inserted oncogene is shown as a patterned domain in

the DNA and its product as a green box. For Rous sarcoma virus the src gene is expressed from a new spliced message.

For Abelson murine leukemia virus the abl gene is present in a fusion protein with a deleted form of gag. Myb and mos

are expressed from spliced Env messages, from which most or all of the env gene has been replaced by the oncogene.

Adapted from Coffin et al. (1997) pp. 5 and 504 and from Fields et al. (1996), p. 1776.

TABLE 6.5 Selected Retroviral Oncogenes

that are crucial for the regulation of cellular pathways.

A sampling of oncogenes that have been found in retrovi-

Oncogene/

Viral

ruses is given in Table 6.5 to illustrate the range of onco-

functional

onco-

genes that have been captured by retroviruses. Oncogenes

proteina

class

Retrovirus

encode protein kinases, receptors that respond to growth

Growth factors

factors, transcription factors, and other proteins that func-

p28env-sis

tion at critical points in the cell regulatory cycle. The reg-

sis

Simian sarcoma virus

ulation of cell growth is complex. In broad outline, cells

Hormone receptor (thyroid hormone receptor)

express receptors that bind growth factors. On binding its

Avian erythroblastosis virusb

p75gag-erbA

erbA

ligand, the receptor signals the cell to synthesize DNA

Tyrosine kinase growth factor receptors

and divide. This signal is often transmitted by means of

Avian erythroblastosis virusb

gp65erbB

erbB

a phosphorylation cascade by which transcription fac-

gp160env-sea

sea

S13 Avian erythroblastosis virus

tors are activated. The activated transcription factors

gp180gag-fms

fms

McDonough feline sarcoma virus

cause mRNAs to be produced that result in the synthesis

gp80gag-kit

kit

Harvey-Zuckerman-4 feline sarcoma virus

of proteins that, in turn, induce DNA synthesis and cell

p68gag-ros

ros

UR2 avian sarcoma virus

division. These activities are regulated in part by inter-

p68gag-mpl

mpl

Mouse myeloproligerative leukemia virus

actions with regulatory proteins called anti-oncogenes,

gp37eyk

eyk

Avian retrovirus RPL30

‡me of which are described in Chapter 7. Thus, onco-

Nonreceptor tyrosine kinases/ signal transduction factors

genes all have in common that overexpression of the pro-

pp60src

tein, or expression of an altered form of the protein that

src

Rous sarcoma virus

p460gag-abl

no longer responds appropriately to regulatory signals,

abl

Abelson murine leukemia virus

leads to unregulated growth. The regulatory signal could

fpsc

p130gag-fps

Fujinami avian sarcoma virus

be, for example, the ligand to which a growth receptor

fesc

p85gag-fes

Snyder-Theilen feline sarcoma virus

normally responds, or domains that interact with inhibi-

p770gag-actin-

fgr

Gardner-Rasheed feline sarcoma virus

tory elements or that normally require phosphorylation

p90gag-yes

yes

Y73 avian sarcoma virus

for activity, or any one of many other mechanisms that

Serine-threonine kinases/signal transduction factors

regulate cell growth.

p37env-mos

mos

Moloney murine sarcoma virus

For some oncogenes, overexpression by the strong ret-

raf d

p75gag-raf

3611 murine sarcoma virus

rovirus promoter is sufficient for cell transformation. The

mil d

p100gag-mil

MH2 avian myelocytoma virus

large amount of oncoprotein overwhelms the cells' regu-

G Proteins (GTPases)

latory abilities, or the protein is expressed in tissues that

p21ras

H-ras

Harvey murine sarcoma virus

normally do not express it and therefore lack the regula-

p21ras

tory machinery to control it. For most oncogenes, however,

K-ras

Kirsten murine sarcoma virus

overexpression is not sufficient and the viral oncogene,

Transcription factors

referred to as v-onc, differs from its cellular counterpart,

p65gag-jun

jun

Avian sarcoma virus 17

referred to as c-onc. The changes in v-onc render the onco-

p55fos

fos

Finkel-Biskis-Jenkins murine sarcoma virus

protein nonresponsive to regulatory controls so that the cell

p200gag-pol-myc

myc

OK10 avian leukemia virus

is always turned on. One mechanism for the loss of regu-

Avian myeloblastosis virusb

p45myb

myb

latory control is the loss of domains that respond to such

Avian myeloblastosis virusb

p135gag-myb-ets

ets

control signals. A second mechanism is point mutations

p64rel

rel

Avian reticuloendotheliosis virus

that arise during the replication of the recombinant retrovi-

p100gag-maf

maf

Avian retrovirus AS42

rus. Mutations occur at high frequency during the replica-

tion of retroviruses but at a very low frequency during the

In these names, p is for protein, gp is for glycoprotein, pp is for

replication of cells.

phosphoprotein, and the numbers are the approximate apparent molecular

The dozens of oncogenes found in retroviruses are too

weight in kD.

numerous to describe here, but a few examples are cited

This is a retrovirus with two oncogenes.

to illustrate specific points. More than one-third of erythro-

fps and fes are the same oncogene derived from the avian and feline

genomes, respectively.

blastosis in chickens induced by oncogene-containing ALVs

raf and mil are the same oncogene derived from the murine and avian

arises from viruses that have captured the erbB gene, and the

genomes, respectively.

viral erbB gene has changes in the C-terminal part of the pro-

Source: Fields et al. (1996) p. 309.

tein (these viruses are called avian erythroblastosis viruses).

that are important in signal transduction. Three different ras

It was noted before that ALV-induced erythroblastosis often

genes have been found in retroviruses and all have changes

results from the provirus integration into the erbB gene.

in codon 12, illustrating the importance of this amino acid

Thus, this gene is very important for the induction of eryth-

for the control pathways that regulate its activity. Mutations

roblastosis. As a second example, Ras proteins are G proteins

in this same codon have also been found in tumors that were

Thus, the probability of transmission of the virus to a new

not produced by retroviruses.

host is low. The appearance of a recombinant retrovirus

Two examples of transcription factor oncogenes will be

expressing an oncogene is an accident that soon disappears

cited. The c-myc gene product is tightly regulated and present

from the population, along with the unfortunate host.

in low amounts in normal cells. It is active on forming het-

erodimers with a second factor, present in larger amounts.

Betaretroviruses

Overexpression of v-myc seems to overwhelm the regulatory

pathways and result in high-level expression of genes required

The best studied member of the betaretroviruses is mouse

for cell proliferation. Even in this case, however, mutations

mammary tumor virus (MMTV). The promoters in the LTR

in v-myc upregulate its transforming ability. Another tran-

respond to estrogen stimulation, consistent with the growth

scription factor, the product of erbA, is a receptor for thyroid

of the virus in mammary epithelium. MMTV occurs as an

hormone. On binding the hormone, it becomes active as a

endogenous virus, present in 04 copies in different strains

transcription factor. v-erbA expresses a modified protein that

of mice. It also occurs as an exogenous virus that infects

no longer needs to bind the hormone in order to be active as

mice by vertical transfer, usually from mother to daughter

a transcription factor, and thus is always on.

through the milk. After a latent period, the virus induces

Often the expression of a single oncogene, whether modi-

mammary tumors with a significant frequency.

fied or not, is not sufficient to achieve full tumorigenic poten-

MMTV encodes a superantigen (the sag gene in Table 6.3).

tial. Some transforming retroviruses have been found to express

As described in Chapter 10, T cells express a receptor that,

two oncogenes, both of which are required for tumor induction.

when stimulated by binding to a peptide antigen recognized

Furthermore, many oncogene-expressing retroviruses induce

by it, causes the cell to become active and divide. Activated

tumors only after a lag and in some cases the tumors are clonal.

T cells induce B cells to proliferate. Superantigens bind to

This suggests that for these viruses, the expression of v-onc is

T-cell receptors and to molecules of the major histocompat-

not in itself sufficient, and additional changes in the infected

ibility complex. Binding is not to the domain of the receptor

cell must occur before it becomes fully tumorigenic.

that interacts with peptide antigen, but to a region shared by

The production of an oncogene-expressing retrovirus that

all T-cell receptors of a given class. A peptide antigen pre-

is capable of inducing a tumor is a rare event, but the presence

sented by major histocompatibility complex molecules may

lead to activation of 10-5 of all T cells. However, the Sag

of the virus is signaled by the tumor itself. Most such viruses

have been isolated from chickens, mice, or cats because these

protein binds to receptors on as many as 10% of all T cells,

animals are commonly infected by C-type retroviruses, but also

leading to their activation. This, in turn, leads to proliferation

because the occurrence of tumors is more likely to be detected

of B cells, which are the first targets of the virus on infec-

in these animals than in many other animals. Chickens are

tion. In this way, the pool of susceptible cells is increased in

processed for human food in very large numbers, and tumors,

size and the infection is amplified. Infected B cells spread the

although rare, are often noticed during processing. Mice are

infection to the mammary glands, where mammary epithe-

used in large numbers in laboratory experiments and receive

lium is infected. The virus induces proliferative changes in

attentive care from investigators. Pet cats are regularly seen

mammary cells, which eventually lead to tumors.

by veterinarians when they become ill.

MasonPfizer monkey virus and the so-called simian

The study of oncogenes that occur in transforming retro-

AIDS virus, or SAIDS virus, are also betaretroviruses. The

viruses has produced a wealth of information about cell reg-

SAIDS virus causes immunodeficiencies in monkeys but is

ulatory pathways by which cell growth and the interactions

distinct from simian immunodeficiency virus (SIV). SIV is

of cells with one another and with various growth hormones

closely related to HIV, described later.

are controlled. Many of these pathways were first discovered

because of the presence of critical components in retrovi-

PTLV Viruses

ruses. Furthermore, some of the oncogenes found in trans-

forming retroviruses were later found to be overexpressed or

The two human T-cell leukemia (or lymphotropic) viruses

to be expressed in a mutant form in human cancers, confirm-

are now usually called primate T-cell lymphotropic viruses

ing the importance of these products in the production of

(PTLV) (Table 6.1). PTLV-1 causes adult T-cell leukemia

human tumors. However, although of great importance for

(ATL) in humans as well as a neurological disorder that has

our understanding of the regulation of eukaryotic cells, and

been termed HTLV-1associated myelopathy (HAM) (from

of importance for the animal in which the tumor produced by

the former name for the virus). The distributions of PTLV-1

the oncogenic retrovirus arose, the transforming retroviruses

and PTLV-2 are shown in Fig. 6.14. PTLV-1 is prevalent

have little significance for the persistence in nature of their

in southern Japan, where transmission appears to be either

retroviral parent. The production of a tumor shortens the life

through sexual intercourse or via breast milk. More than 1

span of the host, and virtually all transforming retroviruses

million people in this region are infected by the virus. The

are defective and require a helper virus for multiplication.

virus is also found in other parts of Asia, in the Caribbean

Equator

Location of PTLV-1 isolates

Areas in which PTLV-1 is endemic

Areas in which PTLV-2 is endemic

Location of PTLV-2 isolates

FIGURE 6.14

Global distribution of PTLV-1 and PTLV-2. Shading indicates the areas of endemism, while the dots

are locations of isolates. For PTLV-1 most of the dots refer to subgroup A isolates, but the B subgroup is found in Zaire,

the D subgroup is found in pygmies in Central Africa, and subgroup C is found in Australia and the islands of Melanesia.

Redrawn from Coffin et al. (1997) Figure 21 on p. 544.

region, and in central Africa, as well as in the United States

encephalopathy in mice, in which inflammation is lacking,

and Western Europe, where it is increasing due to injecting

and many lentiviruses commonly cause neurological disease,

drug use. Blood transfusions have also been implicated in

as will be described later.

the spread of the virus.

PTLV-2 is closely related to PTLV-1. It has been impli-

ATL has a long latent period, 2030 years, and only about

cated as the causative agent of hairy-cell leukemia, but the

1% of infections result in leukemia. Tax is thought to have

number of cases is small and it is not certain that the virus is

a role in induction of leukemia, but the long latent period

in fact responsible for the disease.

implies that other events, probably mutations in the affected

The PTLVs infect not only humans but also a number of

cells, must occur before ATL appears. Patients with acute

nonhuman primates. In any area, the strains of viruses iso-

ATL live only about 6 months on average.

lated from infected humans are more closely related to viruses

HAM is a serious neurological disease. It usually devel-

isolated from monkeys in the region than they are to human

ops more rapidly than ATL, and about 1% of PTLV-infected

strains isolated from another area. Thus, the viruses seem to

humans develop the disease. Demyelination in the spinal

be passed back and forth between monkeys and people.

cord occurs, as well as a vigorous inflammatory response

A virus of cows called bovine leukemia virus (BLV) also

involving T cells and other lymphocytes. It is not known

belongs to this genus of complex retroviruses. This virus causes

whether the pathology is due to damage to virus-infected

B-cell lymphomas in a small fraction of infected animals.

cells by CD8+ T cells (see Chapter 10) or whether the release

of cytokines and chemokines by the inflammatory cells is

Lentiviruses

responsible for the damage.

The retroviruses are best known for their ability to cause

The lentiviruses are complex retroviruses whose core is

tumors, including leukemia, or immunodeficiency, but it is

cone shaped in the mature virion. The most important are

important to note that many retroviruses are associated with

the human immunodeficiency viruses, HIV-1 and -2. Other

neurological diseases. Some of these diseases are character-

members of the genus include a number of simian immu-

ized by an inflammatory response, as is HAM, whereas in

nodeficiency viruses (SIV), feline immunodeficiency virus

others there is no inflammation associated with the disease.

(FIV), bovine immunodeficiency virus (BIV), visna virus

As examples, many strains of MLV cause a spongiform

(which causes disease in sheep), equine infectious anemia

virus (EIAV), and caprine arthritis-encephalitis virus (CAEV)

The primary cellular targets of HIV in infected humans

are macrophages and CD4+ T cells. These cells express CD4,

(Table 6.1). As described earlier, the regulation of lentivirus

replication is complex because lentiviruses encode three to

the primary receptor for all primate lentiviruses, as well as

six accessory genes, depending on the virus, to regulate the

chemokine coreceptors that are also required for entry of the

replication cycle and aid in the assembly of progeny viruses.

virus (Chapter 1). As described in Chapter 1, strains of HIV

All lentiviruses have a specific tropism for macrophages,

are known that preferentially infect macrophages (M-tropic

which comprise the major reservoir of infected cells in an

virus) or that preferentially infect T cells (T-tropic), which

animal. Other cells can also be infected, and this can be

is a function of the env gene of the virus. The infection of

important in the disease process (e.g., CD4+ T cells in HIV

macrophages and of CD4+ T cells differs in several impor-

infection). Lentiviruses establish a lifelong, chronic infec-

tant respects. HIV can replicate in fully differentiated, non-

tion which elicits a vigorous immune response that is unable

dividing macrophages, but infection of macrophages does

to clear the infection. Most known lentiviruses cause seri-

not lead to extensive cytopathology. Efficient replication of

the virus in CD4+ T cells, in contrast, requires that the T cell

ous disease in their native host after a long latent period.

However, SIV produces an asymptomatic, lifelong infec-

be activated (Chapter 10) and results in the death of the cell.

Most infections of CD4+ T cells do result in the death of the

tion of its natural host, African monkeys. Intriguingly, SIV

causes AIDS when transmitted to Asian monkeys.

cell, but the virus is also able to establish a latent infection

in resting memory T cells, which has important implications

for antiviral therapy as described later.

Human Immunodeficiency Virus

A representative time course of the infection of a human

The two human lentiviruses, HIV-1 and HIV-2, cause

by HIV-1 is shown in Fig. 6.15. Primary infection may be

the well-known disease called AIDS (acquired immunode-

asymptomatic (most infected people do not see a doctor on

ficiency syndrome). Although both HIV-1 and HIV-2 cause

primary infection) or accompanied by nonspecific symp-

AIDS in people, HIV-2 is not as serious a pathogen. The

toms that appear 36 weeks after infection. Symptoms may

latent period before disease develops is longer for HIV-2,

include rash, fever, diarrhea, arthralgia, myalgia, nausea,

the virus is not as easily transmissible, and it has not spread

sore throat, lethargy, headache, or stiff neck. The number

of CD4+ T cells declines during this phase. An immune

as extensively as has HIV-1. It is HIV-1 that is responsible

response is mounted that includes both CD8+ cytotoxic T

for the vast majority of AIDS in people, and HIV-1 has cor-

respondingly been much more exhaustively studied.

cells (CTLs) and antibody production (Chapter 10). This

Primary

Death

Infection

1200

Acute HIV Infection

107

1000

Opportunistic

Anti-HIV Immune

Infections

Responses

106

800

Clinical Latency

105

Onset of

600

Symptoms

104

400

AIDS

103

200

102

6 9 12

Weeks

Years

Time after infection

FIGURE 6.15 Typical time course of HIV infection and progression to disease. Patterns of CD4+ T-cell decline and

virus load vary greatly among patients. See also Fig. 6.16 for mortality as a function of initial viral load. Some case

definitions for AIDS specify a CD4+ count below 400 cells/ml (horizontal line). Adapted from Coffin et al. (1997) Figure

5 on p. 600.

In individuals in which viral replication is high, the CD4+

reduces the amount of virus in the blood, the number of

CD4+ T cells recovers but does not reach preinfection levels,

T-cell count declines faster and the time to appearance of

and symptoms of disease ameliorate. However, clearance

AIDS is shorter. The rate of virus replication is probably a

of the virus is not complete, and a long period of clinical

function of the strength of the immune response against the

virus, especially the CD8+ CTL response. Individuals with

latency ensues. During this period, even though the infected

a better immune response control virus replication better

individual is often asymptomatic, the virus continues to rep-

and longer. Once the symptoms of AIDS appear, the time

licate actively, especially in lymph nodes, and the immune

to death is usually 12 years unless antiviral treatment is

system continues to fight the infection. It has been estimated

that during this clinically quiescent period 108 to 1010 virus

administered.

CD4+ T cells, most of which function as T helper cells, are

particles per day are released into the peripheral blood sup-

ply and cleared. During this time the turnover of CD4+ lym-

a critical part of the immune system. They are necessary for

phocytes is also 108 to 109 cells per day.

an immune response to an antigen, whether the response is

to produce CD8+ CTLs or to produce circulating antibodies

In untreated individuals, the continuing replication of

virus results in a steady decline in the number of CD4+ T

(see Chapter 10). AIDS results when so few CD4+ T cells are

cells (Fig. 6.15) and the continuing appearance of mutations

present that the body is unable to mount an effective immune

in the virus. In the Env protein, the rate of change in the

response. A partial list of symptoms that appear and oppor-

amino acid sequence averages about 2.5% per year, with a

tunistic infections that occur is shown in Table 6.6. The first

symptoms usually occur when the CD4+ T-cell concentration

large fraction of changes occurring in certain hypervariable

falls below 500/µl of blood and may include reactivation of

regions. It seems clear that this accumulation of mutations is

driven, at least in part, by immune selection.

viruses such as herpes zoster, reactivation of bacteria such as

Mycobacteria tuberculosis, oral lesions caused by fungi, or

lymph node pathology. These first symptoms are sometimes

AIDS, the Disease

referred to as AIDS-related complex or ARC. Full-blown

AIDS is normally signaled by a drop in the CD4+ T-cell con-

With time the immune system is overwhelmed, with

centration below 200/µl. At this point the infected individual

the result that the replication of HIV escalates, opportu-

nistic fungal, protozoal, bacterial, and viral infections occur,

becomes susceptible to numerous opportunistic infections,

characteristic cancers appear, and neurological symptoms

including those of protozoa such as Pneumocystis carinii,

become apparent. The time to progression to AIDS follow-

bacteria such as Mycobacterium tuberculosis, and fungi such

ing infection by HIV is variable but averages about 10 years.

as Candida albicans. Viruses that are normally controlled

Symptoms occur much sooner in infants infected at birth,

by the immune system become a problem, such as cytome-

perhaps because the immune system is not as well devel-

galovirus and herpes simplex virus. Several virus-induced

oped. In adults infected by the virus, the time to appearance

cancers become common, such as lymphoma caused by

of the symptoms of AIDS is correlated with the level of viral

EpsteinBarr virus, Kaposi's sarcoma caused by human her-

replication during the latent period, as illustrated in Fig. 6.16.

pesvirus 8, or anogenital carcinoma caused by human papilloma

CD4+cells/m l

Viral RNA copies/ml

100

>800

≤4500

500-800

300-500

4500-13000

<300

13000-36000

>36000

Time (years)

FIGURE 6.16 Relationship between the extent of HIV replication or the CD4+ cell count (two different measures of

HIV/AIDS) and clinical progression of disease and time to death. KaplanMeier curves are shown for survival versus

viral load (left) and concentration of CD4+ T cells (right) at time of diagnosis, plotted by quartiles. Redrawn from Mellors

et al. (1996).

TABLE 6.6

Pathology and Opportunistic Infections of Patients with HIV/AIDS

Type of

Stage of HIV/AIDS

Syndrome/symptoms

infectious agent

Organism

CD4+ T-Cell count 200500 cells/ml

Generalized lymphadenopathy

Headache, fever, malaise

Generalized weight loss

Shingles

Viral

Reactivation of herpes zoster

Skin lesions

Viral

Molluscum contagiosum

Basal cell carcinomas of skin

Oral lesions

Thrush

Fungal

Candida albicans

Hairy leukoplakia

Viral

EpsteinBarr virus

Lung disease (tuberculosis)

Bacterial

Reactivation of Mycobacterium tuberculosis

CD4+ T-cell count <200 cells/ml

(Syndromes in addition to those mentioned above)

Microbial Infections

Pneumonia

Protozoan

Pneumocystis carinii

Disseminated toxoplasma

Protozoan

Toxoplasma gondii

Severe diarrhea

Protozoan

Isospora belli

Chronic diarrhea

Protozoan

Cryptosporidia

Tuberculosis

Bacteria

Mycobacterium tuberculosis

Bacterial infections

Bacteria

Salmonella, Streptococcus, Hemophilus,

Cryptococcus

CNS disease

Fungal

Cryptococcus neoformans

Viral Infections and

PML

Viral

JC polyomavirus

Malignancies

Disseminated disease of lungs, brain, etc.

Viral

Genital herpes, cytomegalovirus

B-cell lymphoma

Viral

EpsteinBarr virus, HHV-8

Kaposi's sarcoma

Viral

HHV-8

Anogenital carcinoma

Viral

Human papilloma virus

Cervical carcinoma (in women)

Viral

Human papilloma virus

Other Syndromes

Wasting disease

Aseptic meningitis

AIDS dementia complex

Viral

HIV encephalopathy

Abbreviations: CNS, central nervous system; PML, progressive multifocal leukoencephalopathy; HHV-8, human herpesvirus eight.

Source: Adapted from Coffin et al. (1997) Table 1, p. 597.

this terminal phase, when the immune system can no longer

virus. Many of these opportunistic diseases, such as P. cari-

control viral infection (Fig. 6.15). Early loss of gut-associated

nii pneumonia or Kaposi's sarcoma, are rarely seen in non-

lymphoid tissue (GALT) is an effect of HIV infection and a

HIV-infected people. Others are regularly seen in the general

harbinger of poor prognosis.

population but HIV-infected individuals have a much higher

The lymph nodes are organs that trap invading patho-

incidence of the disease, 100-fold higher in the case of lym-

gens and present them to immune cells. Large numbers of

phoma, for example. Other symptoms of AIDS include a

macrophages and CD4+ T cells are present in lymph nodes,

wasting syndrome and neurological abnormalities, described

and the nodes are sites of active HIV replication. During

later. The symptoms of AIDS become progressively worse

as the CD4+ count continues to drop until virtually no CD4+

the progression of disease following HIV infection, the

cells are present. The decline in numbers of CD4+ cells is

lymph nodes deteriorate. During the final stages of disease,

the architecture of the nodes is completely destroyed and

accelerated by the increased replication of HIV itself during

this loss of lymph node function contributes to the loss of

At the end of 2005, an estimated 40 million people were

immune function.

living with HIV/AIDS, with about 1 million of those in

A wasting syndrome is characteristic of late-stage HIV

North America (Table 6.7). The cumulative death toll from

infection. Bowel involvement results in diarrhea and malab-

AIDS since the beginning of the epidemic now exceeds 25

sorption. The wasting syndrome is thought to be a symptom

million. Five million new infections occurred worldwide in

of HIV infection itself, but opportunistic infections of the

2005, and 3 million people died of AIDS that year. In the

gut probably exacerbate the symptoms in many individuals.

absence of treatment, virtually all infected people go on to

Most HIV-infected individuals suffer, sooner or later,

develop AIDS and die within 2 years of the appearance of

from neurological disease. Some disease is caused by oppor-

the symptoms of AIDS.

tunistic pathogens, such as progressive multifocal leukoen-

The focus of HIV infection is sub-Saharan Africa, where

cephalopathy caused by JC virus (Chapter 7). However,

25 million people, or more than 7% of the population, are

two-thirds of infected individuals develop an encephalopa-

thought to be infected and where medical care is still primi-

thy induced by HIV infection itself that produces symptoms

tive. In the course of the epidemic from 1984 to 2005, the

including dementia, motor and behavioral abnormalities, and

number of HIV infections increased dramatically (Fig. 6.17;

seizures. These symptoms are referred to as AIDS dementia

see also Table 6.7). The extent of the problem is illustrated

complex. HIV is present in the brains of infected individuals

by the fact that in some large cities in sub-Saharan Africa,

in macrophages and microglia, but does not infect neurons.

an estimated 2040% of adults may be infected. The spread

The cause of the neuronal loss induced by HIV infection is

of HIV has resulted in a marked decrease in life expectancy,

unknown.

which has reversed a long period of increasing life expect-

ancy as health care standards have improved (Fig. 6.18).

In other areas of the world, HIV continues to spread but

Spread of AIDS

has not reached the extreme levels found in parts of Africa

HIV is spread sexually, through contaminated blood, and

(Table 6.7). In the Americas and in Southern and Southeast

from mother to child. The virus is present in semen, both

Asia, about 0.6% of the population is infected. Figure 6.19

as free virus and in infected cells, and in vaginal secretions

shows a breakdown of the incidence of AIDS by state in

of infected people, and can be transmitted by either homo-

the United States in 2003. Fig. 6.20 shows the explosive

sexual or heterosexual intercourse. The probability of a

increase in AIDS prevalence in Asia between 1991 and

woman becoming infected during unprotected vaginal inter-

2001. In Western Europe and Australia, estimates are that

course with an infected male is estimated at less than 1/50.

0.3% of the population is infected. Table 6.7 documents the

The risk of a man becoming infected during heterosexual

spread of the virus between 1996 and 2005.

intercourse is less. The risk is much higher if genital lesions

In North America, HIV has been spread primarily

resulting from sexually transmitted diseases are present and

through homosexual contacts and by sharing of needles by

in the absence of circumcision. The risk of infection is also

drug users who inject drugs, but the frequency of hetero-

much higher during receptive anal intercourse. The use of

sexual transmission is increasing. In developing countries,

condoms reduces the risk of transmission by a large factor.

heterosexual contact is the primary mode of transmission.

The virus can also be spread by means of contaminated

The result is that in Africa, the male/female infection ratio

blood, whether through blood transfusions, the use of con-

is approximately 1 to 1, whereas in the United States the

taminated products by hemophiliacs, by needle stick in

male/female ratio is almost 4 to 1 because of the importance

health care workers, the sharing of needles by injecting drug

of male homosexual contacts in the spread of the virus in

users, or via tattoo needles. Blood transfusion was an impor-

this country (Table 6.7). In the United States, the number of

tant source of infection before the development of tests for

newly diagnosed cases of AIDS, especially in white homo-

the virus and remains a problem in developing countries

sexual men, has dropped because awareness of the disease

where blood tests may not be regularly available. Similarly,

has led to the more frequent use of condoms and a lowered

many hemophiliacs became infected before the development

incidence of multiple sex partners, and because more effec-

of blood tests. Use of blood tests and screening of donors

tive drug therapies have been introduced (Fig. 6.21). This

for risk factors have greatly reduced the risk of transmis-

trend may be changing for the worse, however, as the devel-

sion of HIV through blood products in developed countries.

opment of more effective drugs to treat the disease appears

However, transmission among drug users remains an impor-

to have resulted in an increase in unprotected sexual activity.

tant source of infection.

Even as the death rate has declined, the total number of per-

Untreated, infected women transmit the virus to a new-

sons living with HIV/AIDS continues relentlessly upwards.

born child about one-third of the time. Transmission can

The capability of HIV to spread rapidly is illustrated by

occur both during delivery and during breast-feeding. The

its recent spread in Thailand. In Thailand, every male is

use of anti-HIV drugs has reduced transmission to infants in

subjected to compulsory military service and is tested for

countries where the drugs are available.

HIV infection at the age of 18 when called up for military

TABLE 6.7 Characteristics of the Global HIV/AIDS Epidemic

HIV/AIDS in 2005

Number of people with

HIV/AIDS

Deaths from HIV/AIDS

Adult

Primary

Geographical

% Change

prevalence

mode of

region

1996

2005

19962005

1996

2005

19962005

%Women

rate (%)

transmission

Comments 2005

North America

750,000

1.2 million

61,300

18,000

-71

0.7

1. MSM

New diagnoses

2. IDU and

predominantly in

hetero

African Americans

Caribbean

270,000

300,000

14,500

24,000

2.3

Hetero

Haiti has highest

prevalence at 5.6%

Latin America

1.3 million

1.8 million

70,900

66,000

-7

0.6

1. MSM

Brazil accounts for

2. IDU and

>33% of the infected

hetero

persons in this region

Sub-Saharan

14 million

25.8 million

783,700

2.4 million

206

7.2

Hetero

Sub-Saharan Africa has just

Africa

over 10% of the world

population and 60% of

people living with HIV

North Africa and

200,000

510,000

155

10,800

58,000

437

0.2

1. IDU

80% of infected persons in

Middle East

2. Hetero

this region are in Sudan

W. Europe

510,000

720,000

21,000

12,000

-43

0.3

1. MSM

Most infected persons have

2. IDU and

access to treatment

hetero

C. and E. Europe

50,000

1.6 million

3100

1,000

62,000

6100

0.9

1. IDU

Most in the Russian

and Central Asia

2. MSM

Federation, and in

persons <30 years old

South and Southeast 5.2 million

7.4 million

144,000

480,000

233

0.6

Hetero

Epidemic now fueled by new

Asia

infections in India

East Asia

100,000

870,000

770

1,200

41,000

3320

0.1

1. IDU and

Even low prevalence translates

hetero

into large numbers of

2. MSM

infected persons, primarily

in China

Oceaniaa

13,000

74,000

469

1,000

3600

260

0.2

1. MSM

In New Zealand, 85% of new

2. IDU and

transmission is in MSM

hetero

Abbreviations: IDU, injecting drug use; hetero, heterosexual transmission; MSM, sexual transmission among men who have sex with men.

Percent change was calculated as [(Figure for 2005/Figure for 1996) 1] × 100.

Areas with unusually high prevalence or percent increases are highlighted in red, and reduced numbers are shown in blue.

Includes Papua New Guinea, which has the highest prevalence in the region, and Australia and New Zealand which have two of the lowest.

Source: Data through the end of 2004 is from the website: www.unaids.org/epidemic_update/report/ and updated to 2005 with information from "UNAIDS/WHO AIDS Epidemic Update:

December 2005." At the end of 2005 there were 40.3 million people living with HIV/AIDS; during 2005 there were 4.9 million new infections, 3.1 million deaths, 43% of the infected were women,

and the overall prevalence rate was 0.63%.

1991

1984

2001

1999

2004

Percentage of Adults

(15 - 49 yrs)

Infected with HIV

20.01-36%

10.01-20%

5.01-10%

1.01-5%

0-1%

no data

FIGURE 6.17 Explosion of the prevalence of infection with HIV in Africa during the last 20 years. The panels show

the percentage of adults (15 to 49 years old) infected with HIV in various countries of Africa in 1984, 1991, 1999, 2001,

and in 2004. This map was redrawn from Nations Programmes on HIV/AIDS Conference in Geneva, June, 2000 reported

in Schwartlander et al. (2000), and updated with information from the 2006 Report on the Global AIDS Epidemic, from

the UNAIDS Programme.

duty. Twenty years ago HIV was almost unknown in

widely, with the result that the rate of new infections has

Thailand, but within a very few years the disease became

dropped dramatically (Fig. 6.22).

prevalent, infecting some 3% of the male population.

Thailand is a country that is very tolerant of sexual activity

Prevention and Treatment of AIDS

and many young males visit prostitutes. Most of the pros-

titutes became infected with HIV and began to transfer the

The most successful method for the prevention of

infection to many of their male partners, resulting in the

most viral diseases has been the development of vaccines.

observed explosion of infections in the population. In some

However, the development of a vaccine against HIV has

provinces in northern Thailand, as many as 20% of 18-year-

been a very slow, frustrating, and to date unsuccessful proc-

old males were infected with HIV as of 15 years ago. The

ess. This is perhaps not surprising in light of the fact that the

government began an aggressive education campaign about

virus establishes a persistent lifelong infection in the face

the disease and how it is acquired and distributed condoms

of a vigorous immune response on the part of the host that

Botswana

Zimbabwe

Zambia

Uganda

Malawi

1960

1970

1980

1990

2000

Year

FIGURE 6.18 Changes in life expectancy in selected African countries with high HIV prevalence, 1955 to 2005.

Adapted from UNAIDS publications slide 12 of the AIDS in Africa series on the Web site www.UNAIDS.org. and

updated information from the UN Human Development Report 2004. The points plotted at 2005 are projections.

527

179

242

757

6722

184

102

676

733

1906

1514

216

775

1734 506

279

1572

786

368

220

111

404

5967

1102

835

214

778

Rate:

189

628

111

Cases/100,000

1907

509 471

population

3413

1048

4744

5 to 9.9

110

10 to 14.9

District of Columbia

Puerto Rico

≥15

961

1065

Virgin Islands

FIGURE 6.19 AIDS in the United States in 2003. In 2003, a total of 44,232 cases of AIDS were reported in the United

States. In this map, the rate (cases per 100,000 population) is indicated by the color, and the total number of reported cases

is given for each state. The rate for the District of Columbia is so far off scale (169) that a special color is used. Data from

MMWR, Summary of Notifiable Diseases 2003.

1991

Prevalence of HIV infection in

Adults 15 to 49 years old

2.01% - 5%

1.01% - 2%

0.51% - 1.0%

0.1% - 0.5%

<0.01%

No Data Available

Outside Reporting Region

2001

FIGURE 6.20 Prevalence of HIV/AIDS in Asia in 1991 and 10 years later, in 2001, in Adults aged 15 to 49 years.

Note that even at a prevalence of less than 2%, due to its enormous population, India now has roughly 6 million persons

living with HIV/AIDS. Adapted from 2006 Report on the Global AIDS Epidemic, from the UNAIDS Programme.

succeeds in controlling the virus for many years. Vaccine

of behavior, especially sexual behavior. Safe sex practices,

development continues to be a priority, but to the current

such as the use of condoms, have lowered the numbers of

time only public education to slow the spread of the disease

new infections, especially for HIV infections among gay

and the development of antiviral drugs have had any success

white men. Education campaigns in Thailand and Uganda

in control of the virus.

have succeeded in slowing the spread of the disease, and

Much effort has been made to reduce the epidemic spread

similar campaigns in other areas of the world have met with

of HIV by educating the public and thereby altering patterns

at least some success. However, although such campaigns

AIDS cases

New AIDS case definition

450

Deaths

400

Persons living with AIDS

350

Monotherapy

(primarily nucleoside inhibitors)

300

250

200

150

100

Multidrug therapies with

protease inhibitors

Year of diagnosis or death

FIGURE 6.21 Estimated number of AIDS cases and deaths per year of diagnosis among persons >13 years old in the

United States from 1985 to 2003 and number of Americans living with AIDS. Data from AIDS Surveillance-Trends at:

http://www.cdc.gov/hiv/graphics/images/.

160

140

120

100

1985

1987

1989

1991

1993

1995

1997

1999

2001

2003

FIGURE 6.22

New HIV infections per year in Thailand from 1985 to 2003. From: Thailand's Response to HIV/AIDS:

Progress and Challenges (2004) United Nations Development Programme report. Figure 2 on p. 2.

slow the spread of the virus, they do not stop it and will

these analogues into DNA results in premature chain ter-

never succeed in eliminating the virus from the population.

mination, and because the viral RT has a high affinity for

The development of drug therapies for control of HIV

these drugs whereas cellular enzymes have a low affinity for

infection has met with at least partial success. Early drugs for

them, their primary effect is to disrupt replication of HIV.

treatment of HIV infection were disappointing at best (see

However, virus mutants that are resistant to the drugs rapidly

Fig. 6.21). The drug 5¢ azidothymidine (AZT) and related

appear, and control by this agent was found to be of lim-

nucleoside analogues were first used in monotherapy, and

ited duration. Second-generation inhibitors were developed

were initially successful in decreasing virus load and allow-

that interfere with the activity of the viral protease, which is

ing partial recovery of immune function. Incorporation of

required for assembly of infectious virus, or with the viral

integrase. The protease inhibitors have been widely used, and

T cells, although other sources of persistent virus may be

variants resistant to them appear much more slowly, proba-

present. In any event, it appears that the therapy will have to

bly because multiple changes in the protease are required for

be continued over the lifetime of the patient.

resistance. However, resistant virus does eventually emerge

Although HAART has been successful in many patients,

when the inhibitor is used in monotherapy.

it is clearly not a panacea. First, it is very expensive and

Third-generation drug therapy, called highly active

suitable for use only in developed countries that can afford

antiretroviral therapy or HAART, uses a combination of two

a high level of health care. Second, there is significant tox-

different nucleoside analogues and a protease inhibitor. This

icity that results from the drug treatment, making lifelong

treatment has been quite successful in more than half of HIV

treatment problematic. Third, compliance becomes a major

patients, in which the viral load declines to undetectable lev-

issue when any therapy, especially therapy with significant

els with full recovery of immune function. The introduction

side effects, must be continued indefinitely. It may be for

of combined therapy has led to a marked reduction of the

such reasons that the therapy fails in a considerable fraction

death rate from AIDS in the United States (Fig. 6.21). Figure

of HIV patients. Fourth, resistant variants arise, necessitat-

6.23 illustrates that by 1995 AIDS had become the leading

ing changes in the regime of drugs being used. However,

cause of death in U.S. adults 2544 years of age. With the

although this treatment is complex and of limited success,

advent of HAART, AIDS has fallen to the level of homicide

its very existence seemingly has led to a rise in unprotected

as a killer of young adults.

sexual activity and to an upsurge in the rate of HIV infection

At first it was hoped that long-term treatment with this

among populations at risk.

regime would result in the elimination of the virus and cur-

Attempts to develop a vaccine continue and there is hope

ing of the infection. However, this does not appear to be pos-

that a vaccine may ultimately be produced. It is clear that

sible. Virus production quickly resumes when HAART is

an immune response that involves both neutralizing anti-

bodies and CD8+ T cells is important in the control of the

discontinued, even in patients that have been in treatment

virus during the clinically latent state. The T-cell response

for many years without detectable virus production dur-

seems to be especially important. Stronger CTL responses

ing that time. Reemergence of the virus may occur because

result in lower levels of virus production during the latent

the treatment does not eliminate the virus latently infecting

Injuries

HIV-AIDS

Cancer

Unintentional Injuries

Heart Disease

Cancer

Heart Disease

Homicide

Suicide

Suicide

Liver Disease

Stroke

Diabetes

Homicide

Pneumonia and Influenza

HIV and AIDS

1980

1985

1990

1995

2000

2005

Year

FIGURE 6.23 Annual number of deaths in the United States in adults 2544 years old for each of the 10 leading causes

of death, normalized for population growth. The data shown are the aggregate for all races and both sexes, for the years 1980

to 2003. Data came from CDC, National Center for Injury Prevention and Control and National Vital Statistics System.

state, which results in a slower rate of progression to AIDS.

human viruses and humans are the only reservoir. This topic

Neutralizing antibodies are also important, but it has been

is covered in more detail in Chapter 8 on Emerging Viral

found that fresh isolates of virus from patients are difficult

Diseases.

to neutralize, presumably because of the many carbohydrate

chains attached to the HIV surface glycoprotein and because

Nonhuman Lentiviruses

of the unusual folding properties of this protein. In addition,

variants arise during prolonged infection that are resistant to

SIV, FIV, and BIV cause AIDS or an AIDS-like disease in

the mix of antibodies that exist in the patient at the time that

animals. At least 36 different primate species in sub-Saharan

the variants arise.

Africa are infected by different SIVs. These viruses cause no

In developing a vaccine, there is the significant question

disease in their natural hosts but do cause AIDS in Asian mon-

as to whether sterilizing immunity, which is very difficult

keys. The disease in Asian monkeys appears very similar to

to achieve, is required, or whether protection from disease

human AIDS, and SIV has been useful in laboratory studies as

can be obtained with nonsterilizing immunity. For virtually

a surrogate for human AIDS. The primary receptor for SIV is

all other viruses for which vaccines have been developed,

CD4, as is the case for HIV. FIV causes immunodeficiency in

the vaccine is nonsterilizing--subsequent infection with the

cats that appears to result by mechanisms similar to those that

virulent virus results in a subclinical infection that is quickly

produce human AIDS, although the primary receptor for the

virus is different. The number of CD4+ T cells declines mark-

damped out. But with a virus that produces a lifelong persis-

tent infection in the face of an immune response, the needs

edly in the late stages of the disease and the disease is charac-

may be different. Recent findings with a very small group

terized by opportunistic infections as well as by neurological

of patients have suggested that nonsterilizing immunity

symptoms. BIV infection of cattle results in persistent kill-

may suffice, at least in some cases, but more information is

ing of lymphocytes and lesions in the central nervous system,

needed before the complete answer is known.

symptoms that resemble those produced by HIV.

A second, related question is whether is it possible to

In contrast, equine infectious anemia virus (EIAV) in horses,

boost the immune response in people infected with HIV and

caprine arthritis-encephalitis virus (CAEV) in goats, and visna

obtain better control or elimination of the virus. Because of

virus in sheep produce quite different symptoms. EIAV causes

the very long latent period before disease develops, this is

recurrent anemia in horses and is an important veterinary prob-

an extremely difficult question to approach. Various clini-

lem. Primary infection by EIAV results in an acute disease that

cal trials have been conducted to test such possibilities, a

is soon controlled by an immune response. However, variants

topic that is covered in Chapter 11. Clinical trials have also

arise that are resistant to preexisting antibody and cause recur-

been conducted that test the responses of uninfected people

rences of fever and acute anemia. This continues for 6 months

to immunization with the external glycoprotein of HIV. To

to 1 year, after which the infection becomes clinically inappar-

date, such trials have been disappointing.

ent. Infection is lifelong, however, as in all lentiviruses. It is

The possibility of a live virus vaccine is suggested by the

thought that the virus binds to, but does not infect, red blood

finding that a small fraction of infected people exists who

cells. These cells are then destroyed by a complement pathway

have not progressed to AIDS after many years of infection

or by engulfment by macrophages, resulting in the anemia.

and whose CD4+ T-cell count has remained fairly stable. In

The virus also appears to suppress the differentiation of precur-

at least some of these individuals, the infecting HIV strain

sors to red blood cells. Although anemia is the characteristic

has deletions in nef. Initially, experiments with nef deletions

disease produced by EIAV, in a small number of horses virus

in SIV in monkeys give comparable results--the monkeys

infection results in encephalomyelitis.

did not develop AIDS and they were protected for some time

CAEV infection of goats produces an inflammatory

from infection by wild-type strains of SIV. However, they

response that often results in arthritis. The arthritis arises

eventually did succumb to AIDS, illustrating the difficulties

several years after infection and resembles rheumatoid

in developing a live virus vaccine for a virus that establishes

arthritis in humans. Other symptoms produced by infec-

a persistent infection that is ultimately fatal, and for which

tion include encephalomyelitis in 20% of infected animals,

the symptoms of disease are delayed for many years.

which arises within 6 months of infection. Visna virus infec-

tion of sheep follows a similar course, but the characteristic

disease produced is pneumonia, which arises several years

The Origins of HIV

after infection. Encephalomyelitis occurs in less than 5% of

Like measles virus, HIV is a zoonotic disease. HIV-

infected animals.

1 derives from SIV that infects chimpanzees and HIV-2

derives from SIV that infects sooty mangabey monkeys.

Spumaviruses

HIV-1 has entered the human population and become estab-

lished at least three times in the last century, and HIV-2

The spumaviruses comprise a genus of complex retro-

became established independently. These viruses are now

viruses. There are no known human spumaviruses. A virus

and prokaryotic chromosomes have been able to evolve.

previously isolated from human cells in culture, and referred

The number of different kinds of retroelements is conse-

to as human foamy virus or human spumaretrovirus, is now

quently very large and encompasses not only the retrovi-

thought to be a virus of chimpanzees or other monkeys. The

ruses described before but also endogenous retroviruses,

spumaviruses group with epsilon- and gammaretroviruses

retrotransposons of various types, retrointrons, retroplas-

(Fig. 6.1), but differ in many properties from other retrovi-

mids, and retrons, among others. A partial listing of these

ruses. The Gag polyprotein is not cleaved to produce MA,

elements is given in Table 6.8, and the phylogenetic rela-

CA, and NC proteins (Fig. 6.7). Spumaviruses appear to bud

tionships among the RTs of those elements that possess RT

into the endoplasmic reticulum, rather than from the plasma

are shown in the tree in Fig. 6.24.

membrane as do other retroviruses. In addition, Pol is trans-

As a class, retroelements are found in all organisms from

lated from its own mRNA, rather than from the genomic

prokaryotes to mammals. Many of these elements are capa-

RNA as a fusion protein with Gag (Fig. 6.6). Recent studies

ble of amplification and are mobile, able to move within

have also indicated that the RNA of human spumavirus is

the genome. Some encode RT, whereas others utilize RT of

converted to DNA during packaging of the virion. It is pos-

other elements for their propagation. These elements can be

sible that virions may contain either DNA or RNA, since

thought of as selfish DNA. They replicate to fill up the host

both are found in virus preparations. The packaging of DNA

genome to what is, in essence, its carrying capacity. These

in the virion rather than RNA, the translation of Pol from its

elements must be benign and have only limited effects on

own mRNA, and budding into the endoplasmic reticulum,

the replication potential of the organisms in which they

resemble the events that occur in the pararetroviruses such

reside. Otherwise their host would be selected against dur-

as the hepadnaviruses, described later. In other respects, the

ing evolution. The number of retroelements in eukaryotic

spumaviruses resemble retroviruses rather than pararetro-

genomes is often very large. In mammals, 510% of the

viruses. They use a tRNA primer for reverse transcription,

genome appears to consist of endogeneous retroviruses,

like the retroviruses, and their DNA integrates into the host

and all retroelements together comprise about half of the

genome as a provirus. Thus, they are retroviruses that are

genome. The endogeneous retroviruses are provirus-like,

intermediate in their properties between the classical retrovi-

containing LTRs and primer binding sites flanking regions

ruses and the pararetroviruses.

with detectable relationships to gag and pol. Some of these

are active endogenous viruses that have inserted into the

Retroelements in the Genomes of

Living Organisms

TABLE 6.8 Retroelements and Their Distribution in Nature

Reverse transcriptase is an ancient enzyme. Its origins

probably go back to the RNA world at the time of the inven-

Class

Distribution

tion of DNA, when such an enzyme would have been useful

Eukaryotic retroelements

for converting informational RNA molecules into DNA, the

form in which genetic information is now stored. It appears

Retroviruses (Retroviridae

Vertebrates

Table 6.1)

to resemble the RNA polymerases of RNA viruses more than

Pararetroviruses

DNA polymerases or DNA-dependent RNA polymerases,

and may have evolved from a primordial RNA polymerase

Hepadnaviruses (Hepadnaviridae, Mammals, birds

Table 6.10)

of the RNA world. The enzyme still exists in modern eukary-

Caulimoviruses

Plants

otes and plays a role in the replication of eukaryotic cells.

Telomerase is a eukaryotic enzyme that repairs the ends of

Retrotransposons

LTR retrotransposonsa

the linear chromosomes, which are progressively shortened

Animals, plants, fungi, protozoa

during replication. Cells lacking telomerase cease to divide

Non-LTR Retrotransposons

Animals, plants, fungi, protozoa

after the ends of the chromosomes become too short to sup-

Mitochondrial elements

port replication. Telomerase is a ribonucleoprotein enzyme

Group II introns (retrointrons)

Mitochondria of fungi and plants,

that synthesizes repeat sequence elements that are attached

plastids of algae

to the end of the chromosomes. These elements are specific

Mauriceville plasmid

Mitochondria of Neurospora

for a given species. This process involves reverse transcrip-

RTL gene

Mitochondria of Chlamydomonas

tion of an RNA template that is a component of the telomer-

Prokaryotic retroelements

ase, and the ends of the chromosomes serve as primers. The

msDNA-associated RTb

Myxococcus xanthus, E. coli, other

composition of telomerase has not been completely eluci-

bacteria

dated, but it does have a reverse transcriptase activity that is

related to the RT present in a variety of retroelements.

Includes the two families Pseudoviridae and Metaviridae; see Table 6.9.

There has been a long period of time in which elements

msDNA, multicopy single-stranded DNA.

that utilize reverse transcription for insertion into eukaryotic

Source: Adapted from Eickbush (1994), Table 1, p. 122.

Name

Host

Family

Genus

Other Groupings

DHBV

Vert.

Orthohepadnavirus

HBV

Hepadnaviridae

WHBV

Pararetroviruses

Caulimovirus

Plants

CoYMV

Caulimoviridae

CaMV

Plants

Badnavirus

D. m.

412

Metavirus

D. m.

Ty3

Metaviridae

D. m.

Gypsy

Errantivirus

D. m.

17.6

Plants

Ted

MMTV

Betaretrovirus

MPMV

Alpharetrovirus

RSV

Retroviridae

Retroviruses

Vert.

Deltaretrovirus

PTLV

Lentivirus

HIV

Gammaretrovirus

MLV

Spumavirus

HSRV

Copia

D. m.

Hemivirus

D. m.

1731

Pseudoviridae

Tst1

Plants

Pseudovirus

Ty1

Yeast

Telomerases

Human

D. m.

I Factor

D. m.

Poly A transposons

Tad

Neurospora

D. m.

Jockey

D. m.

al1

Yeast

Retrointrons

al2

Mito

Neurospora

Retroplasmids

Ec67

Bacteria

Retrons

Mx65

RNA dependent RNA polymerases

FIGURE 6.24 Phylogenetic tree of the retroelements, based upon the sequences of the reverse transcriptases. The blue

boxes enclose the retroviruses and pararetroviruses. Plant hosts are shown in green, insects in brown, fungi in purple,

vertebrates in blue, and humans in red. The vertical distances are arbitrary; the length of the horizontal branches is

proportional to the number of changes. The tree has been rooted with the RNA-dependent RNA polymerase sequences.

Abbreviations of the retroviruses were given in Table 6.1; abbreviations of orthohepadnaviruses are found in Table 6.10.

Names of representative Pseudoviridae and Metaviridae are given in Table 6.9; the Sirevirus and Semotivirus genera, as

well as four more genera of Caulimoviridae, which are exclusively plant viruses, are not shown. CoYMV is commelina

yellow mottle and CaMV is cauliflower mosaic virus; D. m. is Drosophila melanogaster (fruit fly). Redrawn from Coffin

et al. (1997) Figure 17 on p. 411, plus information from Fauquet et al. (2005), p. 418.

genome recently, whereas others are inert. The time at

ALVs into the chicken genome occurred after chicken and

which any element entered the germ line can often be esti-

turkey separated.

mated from comparative studies of these elements in dif-

Next, four classes of eukaryotic elements, the endog-

ferent animals, and these proviruses or other retroelements

enous retroviruses, the LTR-containing retrotransposons,

constitute a kind of fossil record for these elements. As one

the poly(A)-containing retrotransposons, and the group II

example, chickens have one to four endogenous proviruses

retrointrons, are described in more detail. The relationships

closely related to the ALVs, but there are no such endog-

among these elements and their relationships to the infectious

enous viruses in turkey or quail. Thus, insertion of these

retroviruses described earlier, and to the pararetroviruses

described later, are illustrated by the phylogenetic tree in

although in some animals one or more endogenous retro-

Fig. 6.24. The genetic organizations of these elements are

viruses are normally expressed during the lifetime of an

compared in Fig. 6.25.

animal.

The best studied endogenous retroviruses are those of

chickens and of mice. Mice contain more than 1000 endog-

Endogenous Retroviruses

enous viruses or elements that are thought to have originated

Endogenous retroviruses are proviruses that have become

from endogenous viruses. Most of these are defective and

established in the germ line of many different organisms at

unable to undergo a complete cycle to give rise to infectious

various times in the past. They align with the retroviruses in

virus, but up to 100 copies of nondefective endogenous ret-

the tree in Fig. 6.24, and their genetic organization is identi-

roviruses are present in some strains of mice. As described

cal to that of the simple retroviruses (see Fig. 6.25). Most are

before, these viruses can be ecotropic, xenotropic, poly-

defective, having deletions or mutations in them that prevent

tropic, or modified polytropic, depending on the receptor

them from undergoing a full round of replication. Some are

recognized by their envelope gene. In most strains of mice,

not defective, however, and can, upon activation, give rise to

these viruses are not expressed, although in many cases

progeny virus that can infect other cells. Most endogenous

they can be induced to replicate by treatment of the cell

retroviruses are silent--the genes that they encode are not

with mutagenic agents or agents that lead to demethylation

expressed or are expressed only under restricted conditions,

of DNA. In some strains of mice, the endogenous viruses

Retroviridae

LTR

Pol

Gag

Env

LTR Retrotransposons

Pseudoviridae

LTR

Copia

ORF

LTR

Metaviridae

Gypsy

ORF 2

ORF 1

ORF 3

Non-LTR Retrotransposons

(TAA)n

I Factor

(Drosophila)

ORF 1

ORF 2

AAAAA

(Drosophila)

ORF

Group II Intron

Exon 1

Exon 2

ORF

Polymerase motifs

LTR

Gag-related sequences

Reverse transcriptase

Protease

RNase H

1 kb

Integrase

Env-related sequences

FIGURE 6.25

Comparative genome organizations of retroviruses, retrotransposons, and retrons. In each case the

integrated form of the element is shown, flanked with dark blue bars representing the host DNA. ORFs for each element

are shown below the DNA, and boxes on different lines represent different reading frames. Note that Gypsy has now been

classified as an Errantivirus in the family Metaviridae, and Copia is a Hemivirus in the family Pseudoviridae. Various

motifs related to retroviruses are indicated with different colors and shadings, as shown in the key. At the 3¢ end of many

non-LTR retrotransposons there are a variable number of TAA repeats (I factor) or adenylate residues (R2). Adapted from

Eickbush (1994).

are transcriptionally active and expressed at some stage dur-

retrotransposons are obviously related to retroviruses. The

ing the lifetime of the mouse without having to be induced.

LTRs that they possess are closely related to retroviral LTRs,

Early expression and vigorous replication in strains of mice

including the conserved two terminal nucleotides of the pro-

such as AKR leads to the development of leukemia in most

virus. They have tRNA primer binding sites and polypurine

of these mice.

tracts, so that reverse transcription of the RNA appears to

An interesting question deals with how the xenotropic

follow the same pathways as in retroviruses.

viruses, which cannot infect mice, entered the mouse germ

Thus, the LTR-containing retrotransposons are effec-

line. The simplest explanation would be that these viruses

tively intracellular viruses that replicate only within an

entered the germ line of an ancestor of the modern mouse

individual cell. As such they have recently been classified

that did express receptors for the virus. In this model, dur-

into two families of virus-like agents, the Pseudoviridae

ing the evolution of mice these receptors were silenced or

and the Metaviridae (Table 6.9). These agents are ancient,

mutated to a form that was no longer usable by the xeno-

being found in plants, insects, and fungi as well as in animals

tropic viruses. It is possible that modern mice were selected

including vertebrates. The argument has been made that the

to not express a functional receptor for these viruses, in order

Metaviridae gave rise to the current retroviruses, that they

to minimize the virus load from endogenous viruses.

represent an ancestral form of retroviruses in which an RT-

containing element became mobile by associating with gag-

like genes that allowed it to spread within the cell. Later

LTR-Containing Retrotransposons

acquisition of an envelope gene in vertebrate Metaviridae

The LTR-containing retrotransposons are essentially

gave rise to a complete retrovirus. The Metaviridae lineage

endogenous retroviruses that lack the envelope gene (Fig.

is a sister lineage to the Retroviridae as shown in Fig. 6.24,

6.25B). They contain LTRs and encode Gag-related pro-

consistent with this hypothesis.

teins, protease, and RT with its associated activities. RNA

The two families of LTR retrotransposons, which rep-

transcribed from the elements is translated to produce Gag

resent two independent evolutionary lines (Fig. 6.24), each

and Pol, and the RNA is assembled into intracellular cap-

contain three genera (Table 6.9). In the Metaviridae are Ty3

sid-like particles that reverse transcribe it back into DNA.

of yeast and Gypsy of Drosophila, among other elements.

Subsequent integration into the genome allows the elements

They are closely related to the pararetroviruses of plants

to spread within the genome. Further, the LTR-containing

(Fig. 6.24). The Pseudoviridae contain Ty1 of yeast and

TABLE 6.9 LTR Retrotransposons

Family/genera/

Type virus name

type virus

abbreviation

Transmission

Distribution

Comments

Pseudoviridae (LTR retrotransposons of the Ty1-copia family)

Pseudovirus

Exclusively vertical

Worldwide

Genus contains several other viruses of

Saccharomyces cerevisiae

SceTy1V

plants and fungi

Ty1 virus

Hemivirus

Unknown

Worldwide

Found in insect, fungal, and viral genomes

Drosophila melanogaster

DmeCopV

copia virus

Serivirus

Unknown

This genus found only in plants

Glycine max SIRE1 virus

GmaSIRV

Metaviridae (LTR retrotransposons of the Ty3-gypsy family)

Metavirus

Unknown

Genus contains several other viruses of

plants, insects, and fungi

Saccharomyces cerevisiae

SceTy3V

Ty3 virus

Errantivirus

Unknown

Most infect insects

Drosophila melanogaster

DmeGypV

gypsy virusa

Semotivirusa

Unknown

Primarily in nematodes, but also insects

and vertebrates

Ascaris lumbricoides

AluTasV

Tas virus

All members of these genera have a env-like ORFs, but the ORFs of errantiviruses have no sequence similarity to those of semotiviruses.

Source: Fauquet et al. (2005).

Search WWH :

Custom Search

Viruses And Human Disease Topic Index

Viruses And Human Disease Bookmarks

Home