An Overview of the Replication Cycle of Viruses

which is circular and largely double stranded. Thus their

of the genome. Genera are grouped into families, which

genome replicates through an RNA intermediate (DNA →

can be considered the fundamental unit of virus taxonomy.

RNA → DNA). Just as the minus-strand RNA viruses and

Classification into families is based on the type and size of

double-strand RNA viruses package their replicase proteins,

the nucleic acid genome, the structure of the virion, and the

the retroviruses package active RT, which is required

strategy of replication used by the virus, which is determined

to begin the replication of the genome in the virions.

in part by the organization of the genome. Groupings into

Although in many treatments the retroviruses are

families are not always straightforward because little or no

considered with the RNA viruses and the hepadnaviruses

sequence identity is present between members of different

with the DNA viruses, we consider these viruses to form

genera. However, uniting viruses into families attempts to

a distinct class, the RT-encoding class, and in this topic

recognize evolutionary relationships and is valuable for

references to RNA viruses or to DNA viruses are not meant

organizing information about viruses.

to apply to the retroviruses or the hepadnaviruses.

Higher taxonomic classifications have not been recognized

All viruses, with one exception, are haploid; that is, they

for the most part. To date only three orders (Caudovirales,

contain only one copy of the genomic nucleic acid. The

Nidovirales, Mononegavirales) have been established that

exception is the retroviruses, which are diploid and contain

group together a few families. Taxonomic classification at

two identical copies of the single-stranded genomic RNA.

higher levels is difficult because viruses evolve rapidly and

The nucleic acid genome may consist of a single piece of

it can be difficult to prove that any two given families are

DNA or RNA or may consist of two or more nonidentical

descended from a common ancestor, although it is almost

fragments. The latter can be considered analogous to chro-

certain that higher groupings based on common evolution

mosomes and can reassort during replication. In the case

do exist and will be elucidated with time. Viral evolution

of animal viruses, when a virus has more than one genome

involves not only sequence divergence, however, but also the

segment, all of the different segments are present within a

widespread occurrence of recombination during the rise of the

single virus particle. In the case of plant viruses with mul-

modern families, a feature that blurs the genetic relationships

tiple genome segments, it is quite common for the different

between viruses. Two families may share, for example, a

genome segments to be separately encapsidated into differ-

related polymerase gene but have structural protein genes that

ent particles. In this case, the infectious unit is multipartite:

appear unrelated; how should such viruses be classified?

Infection to produce a complete replication cycle requires

The ICTV has recognized 5450 viruses as species (more

simultaneous infection by particles containing all of the dif-

than 30,000 strains of viruses exist in collections around

ferent genome segments. Although this does not seem to pose

the world), and classified these 5450 species into 287 genera

a problem for the transmission of plant viruses, it must pose a

belonging to 73 families plus a number of "floating" genera that

problem for the transmission of animal viruses since such

have not yet been assigned to a family. An overview of

animal viruses have not been found. This difference probably

these families, in which viruses that cause human disease

arises because of different modes of transmission, the fact

are emphasized, is shown in Table 1.2. Included in the table

that many plant viruses grow to exceptionally high titers, and

is the type of nucleic acid that serves as the genome, the

the fact that many plants grow to very high density.

genome size, the names of many families, and the major

groups of hosts infected by viruses within each grouping.

For many families the names and detailed characteristics are

The ICTV Classification of Viruses

not shown here, but a complete listing of families can be

The International Committee on Taxonomy of Viruses

found in the reports of the ICTV on virus taxonomy or in

The Encyclopedia of Virology (2nd ed.). Tables that describe

(ICTV), a committee organized by the Virology Division

of the International Union of Microbiological Societies, is

the members of families that infect humans are presented in

attempting to devise a uniform system for the classification

the chapters that follow in which the various virus families

and nomenclature of all viruses. Viruses are classified into

are considered in some detail.

species on the basis of a close relationship. The decision as

to what constitutes a species is arbitrary because a species

usually contains many different strains that may differ sig-

AN OVERVIEW OF THE REPLICATION CYCLE

nificantly (10% or more) in nucleotide sequence. Whether

OF VIRUSES

two isolates should be considered as being the same spe-

cies rather than representing two different species can be

Receptors for Virus Entry

controversial. Virus species that exhibit close relationships

The infection cycle of an animal virus begins with its

are then grouped into a genus. Species within a genus usu-

attachment to a receptor expressed on the surface of a sus-

ally share significant nucleotide sequence identity demon-

ceptible cell, followed by penetration of the genome, either

strated by antigenic cross-reaction or by direct sequencing

TABLE 1.2

Major Virus Families

Major hosts (number of members infecting that host)a

Nucleic acid

Genome size

Segments

Family

Genera

Vertebrates (35 + 9T)b, insects (27), plus 15 Uc

DS DNA

130375 kbp

Poxviridae

8+3

170190 kbp

Asfariviridae

Vertebrates (1)

170400 kbp

Iridoviridae

3+2

Vertebrates (2 + 5T), insects (6 + 11T)

120220 kbp

Herpesviridae

Vertebrates (61 + 7T + 56U)

80180 kbp

Baculoviridae

Insects (36 + 8T)

2848 kbp

Adenoviridae

Vertebrates (32 + 9T)

5 kbp

Polyomaviridae

Vertebrates (12)

6.88.4 kbp

Papillomaviridae

Vertebrates (7 + 88T + 13U)

Various

Several families

Bacteria (42 + 368T)

SS DNA

46 kbp

Parvoviridae

5+4

Vertebrates (33 + 3T), insects (6 + 18T)

Various

Several families

Bacteria (43 + 38T), plants (98 + 11T)

DS RNA

2030 kbp

1012

Reoviridae

6+2+4

Vertebrates (52 + 24T), insects (1 + 7T), plants (13 + 1T)

5.9 kbp

Birnaviridae

2+1

Vertebrates (3), insects (1)

4.67.0 kbp

1 or 2

Three families

Fungi (7 + 7T), plants (30 + 15T), protozoans (14)

SS (+)RNA

2833 kb

Coronaviridae

Vertebrates (17 + 1T)

1316 kb

Arteriviridae

Vertebrates (4)

1013 kb

Togaviridae

Vertebrates (insect vectors)(28)

1012 kb

Flaviviridae

Vertebrates (some insect vectors) (59 + 4T)

78.5 kb

Picornaviridae

Vertebrates (30 + 1T + 23U)

78 kb

Astroviridae

Vertebrates (9)

8 kb

Caliciviridae

Vertebrates (6 + 1T)

7.2 kb

Hepeviridae

Vertebrates (1)

Various

1 to 3

Many families

Plants (496 + 84T + 5U)

SS (-)RNA

1516 kb

Paramyxoviridae

Vertebrates (34 + 2U)

19 kb

Filoviridae

Vertebrates (5)

1116

Rhabdoviridae

4+2

Vertebrates (23 + 25T + 40U), invertebrates (20U), plants (15)

6 kb

Bornaviridae

Vertebrates (1)

1015 kb

Orthomyxoviridae

Vertebrates (7)

1223 kb

Bunyaviridae

4+1

Vertebrates and insect vectors (86 + 20T), plants (9 + 7T)

11 kb

Arenaviridae

Vertebrates (19 + 1T)

SS RNA RT

710 kb

dimer

Retroviridae

Vertebrates (53 + 2T)

DNA Intermediate

DS DNA RT

3 kb

Hepadnaviridae

Vertebrates (5 + 1T)

RNA intermediate

8 kb

Caulimoviridae

Plants (26 + 10T)

RNA intermediate

Vertebrates in red indicate humans are among the vertebrates infected. Vertebrates in blue indicate non-human hosts only; plant hosts are in green; insect

hosts in yellow; bacterial hosts are black.

T = tentatively assigned to a particular genus.

U = assigned to the family, but not to any particular genus within the family.

Source: Data for this table is from Fauquet et al. (2005).

naked or complexed with protein, into the cytoplasm.

sory receptor is not required for virus entry even where used,

Binding often occurs in several steps. For many viruses, the

but such binding does accelerate the rate of binding and

virion first binds to an accessory receptor that is present in

uptake of the virus.

high concentration on the surface of the cell. These accessory

Binding to a high-affinity, virus-specific receptor is

receptors are usually bound with low affinity and binding

required for virus entry, and virus may be transferred to its

often has a large electrostatic component. Use of accessory

high-affinity receptor after primary binding to an accessory

receptors seems to be fairly common among viruses adapted

receptor, or may bind directly to its high-affinity receptor.

to grow in cell culture but less common in primary isolates

Cells that fail to express the appropriate receptor cannot be

of viruses from animals. This first stage binding to an acces-

infected by the virus. These receptors are specifically bound

by one or more of the external proteins of a virus. Each virus

disparate receptors. Fig. 1.4 illustrates a number of receptors

uses a specific receptor (or perhaps a specific set of recep-

used by different retroviruses (family Retroviridae). These

tors) expressed on the cell surface, and both protein recep-

receptors differ widely in their structures and in their cellular

tors and carbohydrate receptors are known. In some cases,

functions. Where known, the region of the cellular receptor

unrelated viruses make use of identical receptors. A protein

that is bound by the virus is indicated. Table 1.3 lists recep-

called CAR (Coxsackie-adenovirus receptor), a member of

tors used by different herpesviruses (Herpesviridae) and dif-

the immunoglobulin (Ig) superfamily, is used by the RNA

ferent coronaviruses.

virus Coxsackie B virus (Picornaviridae) and by many ade-

In addition to the requirement for a high-affinity or pri-

noviruses (Adenoviridae), which are DNA viruses. Sialic

mary receptor, many viruses also require a coreceptor in

acid, a carbohydrate attached to most glycoproteins, is used

order to penetrate into the cell. In the current model for

by influenza virus (family Orthomyxoviridae), human coro-

virus entry, a virus first binds to the primary receptor and

navirus OC3 (family Coronaviridae), reovirus (Reoviridae),

then binds to the coreceptor. Only on binding to the core-

bovine parvovirus (Parvoviridae), and many other viruses.

ceptor can the virus enter the cell. The best studied example

Conversely, members of the same viral family may use widely

is HIV, which uses the cell surface molecule called CD4 as

A. Gammaretrovirus Receptors

Host cell

plasma

membrane

Virus

MoMLV

GALV/FeLV

MLV

Amphotropic

Ecotropic

Type

hPiT-1

rPiT-2

mCAT-1

Protein

679

652

622

# amino acids

Phosphate transporter

Similar to hPiT-1

Basic amino acid

Protein type

transporter

B. Other Retrovirus Receptors

Host cell

plasma

membrane

BLV

ALV (subgroup A)

Virus

HIV

Deltaretrovirus

Genus

Alpharetrovirus

Lentivirus

BLV receptor

Protein

Tv-a

CD4 + CXCR4 (or CCR5)

730

# amino acids

369

458 + 353

Unknown

Protein type

LDL-receptor-like

Immunoglobulin and

chemokine receptor

Region to which env

Transmembrane domains

Disulfide bridges

proteins bind

FIGURE 1.4

Cellular receptors for retroviruses. The structures of various retrovirus receptors are shown schematically

to illustrate their orientation in the cell plasma membrane. The receptors for the gammaretroviruses contain multiple

transmembrane domains and have known cellular functions. The HIV receptor consists of a molecule of CD4 plus a

chemokine receptor such as CXCR4. The receptor for alpharetroviruses is a Type II membrane protein similar to the

LDL receptor, with the N terminus in the cytoplasm. Little is known about the cellular function of the BLV receptor,

other than its orientation as a Type I membrane protein. Abbreviations: MLV, murine leukemia virus; GALV, gibbon/ape

leukemia virus; FeLV, feline leukemia virus; HIV, human immunodeficiency virus; ALV, avian leukosis virus; BLV,

bovine leukemia virus; LDL, low density lipoprotein. Adapted from Fields et al. (1996) p. 1788 and Coffin et al. (1997)

pp. 7682.

TABLE 1.3 Viruses Within a Family that Use Unrelated Receptors

Family

Virus

High-affinity receptor

Accessory receptor

Herpesviridae

Alpha

Herpes simplex

HIgR (CD155 family)

Heparan sulfate

HVEM (TNF receptor family)

Pseudorabies

140 kD heparan sulfate proteoglycan

85 kD integral membrane protein

CD155 and related proteins

Beta

Cytomegalovirus

protein?? unidentified

Heparan sulfate

Gamma

Bovine herpesvirus

56 kD protein

Heparan sulfate

Epstein Barr

CD21 (CR2 receptor)

Coronaviridae

Group 1

TGEVa

Porcine APN: aminopeptidase N

Porcine

FIPVa

Feline

Feline APN: aminopeptidase N

Human

229e

Human APN: human aminopeptidase N

Human

NL63

ACE2: Human angiotensin-converting enzyme 2

Group 2

Human

SARS

ACE2: Human angiotensin-converting enzyme 2

Murine

Mouse hepatitis

CEACAM1: Carcinoembryonic antigen-related cell

adhesion molecule 1b

Bovine

Bovine coronavirus

Sialic acid residues on glycoproteins and glycolipids

Virus abbreviation: TGEV, transmissible gastroenteritis virus (of swine); FIPV, feline infectious peritonitis virus.

Note that entry of mouse hepatitis variants of extended host range is independent of CEACAM1, and instead uses heparan sulfate as an entry receptor.

a primary receptor and various chemokines as coreceptors

Other surface proteins used as receptors include the

vibronectin receptor αvβ3, used by several members of the

(see later).

The nature of the receptors utilized by a virus determines

Picornaviridae; aminopeptidase N, used by some corona-

in part its host range, tissue tropism, and the pathology of the

viruses; CD55, used by Coxsackie A21 virus; the different

disease caused by it. Thus, the identification of virus recep-

proteins illustrated in Fig. 1.4; and other proteins too numer-

tors is important, but identification of receptors is not always

ous to describe here. The receptors used by four viruses

straightforward.

are described in more detail as examples of the approaches

used to identify receptors and their importance for virus

pathology.

Primary (High-Affinity) Receptors

One well-characterized receptor is that for poliovirus,

Many members of the Ig superfamily are used by viruses

which attaches to a cell surface molecule that is a member

as high-affinity receptors, as illustrated in Fig. 1.5. The Ig

of the Ig superfamily (Fig. 1.5). The normal cellular func-

superfamily contains thousands of members, which play

tion of this protein is unknown. It was first called simply

important roles in vertebrate biology. The best known mem-

the poliovirus receptor or PVR, but has now been renamed

bers are found in the immune system (Chapter 10), from

CD155, following a scheme for the designation of cell sur-

which the family gets its name. Members of this superfamily

face proteins. Poliovirus will bind only to the version of this

contain one or more Ig domains of about 100 amino acids that

molecule that is expressed in primates, and not to the version

arose by duplication of a prototypical gene. During evolu-

expressed in rodents, for example. Thus, in nature, polio-

tion of the superfamily, thousands of different proteins arose

virus infection is restricted to primates. Although chicken

by a combination of continuing gene duplication, sequence

cells or most mammalian cells that lack CD155 are resistant

divergence, and recombination. Many proteins belonging to

to poliovirus infection, they can be transfected with the viral

this superfamily are expressed on the surface of cells, where

RNA by a process that bypasses the receptors. When infected

they serve many functions, and many have been usurped by

in this way, they produce a full yield of virus, showing that

animal viruses for use as receptors.

the block to replication is at the level of entry.

HLA

Carcinoembryonic CD4

CD155

ICAM-1

HIgR

Receptor

antigens

Virus

Semliki

mouse

HSV1, HSV2

HIV-1

poliovirus rhinovirus

bovine herpesvirus Forest

hepatitis

Togaviridae

Coronaviridae

Retroviridae

Picornaviridae

Herpesviridae

Family

dsDNA-large

ssRNA

RNA/RT

ssRNA-small

Genome

enveloped

nonenveloped

FIGURE 1.5 Diagrammatic representation of immunoglobulin superfamily membrane proteins that are used as

receptors by viruses. The domains indicated by cross-hatching have been shown to be required for receptor activity.

ssRNA, single-strand RNA; dsDNA, double-strand DNA; RNA/RT, RNA reverse transcribed into DNA.

Cells lacking CD155 have been transfected with expres-

be faithfully reproduced. Although these transgenic mice can

sion clones so that they express CD155, and these modified

be infected only by injection of virus and not by ingestion,

cells are sensitive to infection with poliovirus. This was, in

the normal route of poliovirus infection in humans, a small

fact, the way the receptor was identified. Such a system also

animal model for poliomyelitis is valuable for the study of

allows the testing of chimeric receptors, in which various

virus pathology or for vaccine development. To date, our

domains of CD155 come from the human protein and other

information on the pathology of poliovirus in the CNS was

parts come from the homologous mouse protein, or even

obtained only from experimental infection of nonhuman

from entirely different proteins like CD4. In this way it was

primates, which are very expensive to maintain, or from

shown that only the distal Ig domain from human CD155

humans naturally infected with the virus.

(cross-hatched in Fig. 1.5) is required for a chimeric protein

As a second example of virusreceptor interactions, HIV

to function as a receptor for poliovirus.

utilizes as its receptor a cell surface molecule known as CD4,

In humans, CD155 is expressed on many cells, including

which is also a member of the Ig superfamily (Figs 1.4 and

cells of the gut, nasopharynx, and the central nervous system

1.5). As described later, a coreceptor is also required. CD4

(CNS). Infection begins in the tonsils, lymph nodes of the

is primarily expressed on the surface of certain lymphocytes

neck, Peyer's patches, and the small intestine. In more than

(described in more detail in Chapter 10). Furthermore, the

98% of cases, the infection progresses no further and no ill-

virus has a narrow host range and will bind with high effi-

ness, or only minor illness, results. In some cases, however,

ciency only to the human version of CD4 (Fig. 1.4). Thus,

virus spreads to the CNS, probably both by passing through

humans are the primary host of HIV. Immune function

is impaired over time as helper CD4+ T cells, which are

the bloodbrain barrier and through retrograde axonal trans-

port. Once in the CNS, the virus expresses an astounding

required for an immune response directed against infectious

preference for motor neurons, whose destruction leads to

agents, are killed by virus infection, leading to the observed

paralysis or even death via a disease called poliomyelitis.

syndrome of AIDS (acquired immunodeficiency syndrome).

This preference for motor neurons, and the failure of the

The virus can also infect cells of the monocyte-macrophage

virus to grow in other tissues, is not understood. Athough

lineage, and possibly other cells in the CNS, leading to

CD155 is required for virus entry, other factors within the

neurological manifestations.

cell are also important for efficient virus replication.

As a third example of virusreceptor interaction, among

Making use of the CD155 gene, transgenic mice have

the receptors used by Sindbis virus (family Togaviridae)

been generated in which the syndrome of poliomyelitis can

is the high-affinity laminin receptor. Sindbis virus is an

arbovirus, that is, it is arthropod-borne. In nature it alternates

proteins, one called HIgR (for herpesvirus Ig-like receptor)

between replication in mosquitoes, which acquire the virus

and the other called either PRR-1 (for poliovirus receptor

when they take a blood meal from an infected vertebrate, and

related) or HveA (for herpesvirus entry mediator A), appear

higher vertebrates, which acquire the virus when bitten by

to be splice variants that have the same ectodomain.

an infected mosquito. The high-affinity laminin receptor is a

Heparan sulfate may serve as an accessory receptor for

cell adhesion molecule that binds to laminin present in base-

the other viruses shown in Table 1.4, or it may serve as a pri-

ment membranes. It has been very highly conserved during

mary receptor for some or all. It was thought that it may be

evolution, and Sindbis virus will bind to both the mosquito

a primary receptor for dengue virus (family Flaviviridae),

version and the mammalian version of this protein. Viruses

but recent work has identified other candidates as the pri-

with broad host ranges, such as arboviruses, must use recep-

mary receptor. In the case of Sindbis virus, the situation is

tors that are highly conserved, or must have evolved the

complex and interesting. Primary isolates of the virus do

ability to use different receptors in different hosts.

not bind to heparan sulfate. Passage of the virus in cultured

Finally, as a fourth example, the receptor for influenza

cells selects for viruses that do bind to heparan sulfate, and

virus (family Orthomyxoviridae) is sialic acid covalently

which infect cultured cells more efficiently. It is thought

linked to glycoproteins or glycolipids present at the cell sur-

that selection for heparin sulfate binding upon passage of

face. Because sialic acid is expressed on many different cells

the virus in the laboratory speeds up the process of infec-

and in many different organisms, the virus has the potential to

tion in cultured cells because virus bound to the cell surface

have a very wide host range. The virus infects many birds and

by binding to heparin sulfate can diffuse in two dimensions

mammals, and its maintenance in nature depends on its ability

rather than three to encounter its high-affinity receptor. In

to infect such a broad spectrum of animals. The epidemiology

infected animals, however, heparin sulfate binding attenu-

of influenza virus will be considered in Chapter 4.

ates the virus, perhaps allowing the animal to clear the virus

more quickly.

Many viruses absolutely require a coreceptor for entry,

Accessory Receptors and Coreceptors

in addition to the primary receptor to which the virus first

binds. The best studied example is HIV, which requires one

The process by which a virus binds to a cell and pen-

of a number of chemokine receptors as a coreceptor. Thus a

etrates into the cytoplasm may be complicated by the par-

ticipation of more than one cellular protein in the process.

Some viruses may be able to use more than one primary

TABLE 1.4 Viruses That Bind to Heparin-Like

receptor, which thus serve as alternative receptors. Second,

Glycosaminoglycans

many viruses appear to first bind to a low-affinity receptor

or accessory receptor before transfer to a high-affinity recep-

Virus

Family

High affinity receptor

tor by which the virus enters the cell. Third, many viruses

absolutely require a coreceptor, in addition to the primary

RNA viruses

Sindbis

Togaviridae

High affinity laminin

receptor, for entry.

receptor

Many viruses, belonging to different families, have been

Dengue

Flaviviridae

???

shown to bind to glycosoaminoglycans such as heparan sul-

Hepatitis C

Flaviviridae

CD81

fate (Table 1.4), which are expressed on the surface of many

αvβ3 integrin

Foot and mouth disease

Picornaviridae

cells. In at least some cases, however, such as for human her-

pes simplex virus (HSV) (family Herpesviridae), heparan

Respiratory syncytial

Paramyxoviridae

???

sulfate is not absolutely required for the entry of the virus.

Retroviruses

Cells that do not express heparan sulfate or from which it has

HIV-1

Retroviridae

CD4 (Ig superfamily)

been removed can still be infected by HSV. Heparan sulfate

does dramatically increase the efficiency of infection, how-

DNA viruses

ever. The current model is that HSV first binds to heparan

Vaccinia

Poxviridae

EGF receptor ???

sulfate with low affinity and is then transferred to the pri-

Syndecan-1a

Human papillomavirus

Papillomaviridae

mary receptor for entry. In this model, heparan sulfate serves

Herpes simplex

Herpesviridae

HIgR (CD155 family)

an accessory function, which can be dispensed with.

Adeno-associated type 2 Parvoviridae

FGFR1

The primary receptor for HSV has now been identified

as a protein belonging to the Ig superfamily (Fig. 1.5). This

In this case the heparan sulfate proteoglycan appears to be the primary

protein is closely related to CD155, and, in fact, CD155 will

receptor protein.

serve as a receptor for some herpesviruses, but not for HSV.

Abbreviations used: EGF receptor, epidermal growth factor receptor;

The story is further complicated by the fact that more than

HIgR, herpes immunoglobulin-like receptor; CD155, the poliovirus

one protein can serve as a receptor for HSV. Two of these

receptor; FGFR1, human fibroblast growth factor receptor 1.

mouse cell that is genetically engineered to express human

by insect or fungal pests, in fact, with which the virus has a

CD4 will bind HIV, but binding does not lead to entry of the

specific association. There remains the possibility that spe-

virus into the cell. Only if the cell is engineered to express

cific receptors will be identified in the future, however, for

both human CD4 and a human chemokine receptor can the

at least some plant viruses.

virus both bind to and enter into the cell. It is thought that

binding to the first or primary receptor induces conforma-

Penetration

tional changes in the virion that allow it to bind to the second

or coreceptor.

After the virus binds to a receptor, the next step toward

The requirement for a coreceptor has important impli-

successful infection is the introduction of the viral genome

cations for the pathology of HIV. Chemokines are small

into the cytoplasm of the cell. In some cases, a subviral par-

proteins, secreted by certain cells of the immune system, that

ticle containing the viral nucleic acid is introduced into the

serve as chemoattractants for lymphocytes. They are impor-

cell. This particle may be the nucleocapsid of the virus or

tant regulators of the immune system and are described in

it may be an activated core particle. For other viruses, only

Chapter 10. Different classes of lymphocytes express recep-

the nucleic acid is introduced. The protein(s) that promotes

tors for different chemokines at their surface. To simplify the

entry may be the same as the protein(s) that binds to the

story, macrophage-tropic (M-tropic) strains of HIV, which is

receptor, or it may be a different protein in the virion.

the virus most commonly transmitted sexually to previously

For enveloped viruses, penetration into the cytoplasm

uninfected individuals, require a coreceptor called CCR5 (a

involves the fusion of the envelope of the virus with a cel-

receptor for β chemokines). Human genetics has shown that

lular membrane, which may be either the plasma membrane

two mutations can block the expression of CCR5. One is a

or an intracellular membrane. Fusion is promoted by a

32-nucleotide deletion in the gene, the second is a mutation

fusion domain that resides in one of the viral surface pro-

that results in a stop codon in the CCR5 open reading frame

teins. Activation of the fusion process is thought to require a

(ORF). The deletion mutation is fairly common, present in

change in the structure of the viral fusion protein that exposes

about 20% of Caucasians of European descent, whereas the

the fusion domain. For viruses that fuse at the plasma mem-

stop codon mutation has been reported in only one indi-

brane, interaction with the receptor appears to be sufficient

vidual. Individuals who lack functional CCR5 because they

to activate the fusion protein. In the case of viruses that

are homozygous for the deleted form, or in the case of one

fuse with intracellular membranes, the virus is internalized

individual, heterozygous for the deletion but whose second

via various cellular vesicular pathways, which may differ

copy of CCR5 has the stop codon, are resistant to infection

depending upon the virus. The best studied internalization

by HIV. Heterozygous individuals who have only one func-

process is endocytosis into clathrin-coated vesicles and pro-

tional copy of the CCR5 gene appear to be partially resist-

gression through the endosomal pathway. During transit,

ant. Although they can be infected with HIV, the probability

the clathrin coat is lost and the endosomes become progres-

of transmission has been reported to be lower, and once

sively acidified. On exposure to a defined acidic pH (often

infected, progression to AIDS is slower. During the course

~56), activation of the fusion protein occurs and results in

of infection by HIV, T-cell-tropic strains (T-tropic) of HIV

fusion of the viral envelope with that of the endosome. In

arise that require a different coreceptor, called CXCR4 (a

either case, the nucleocapsid of the virus is present in the

receptor for α chemokines). After the appearance of T-tropic

cytoplasm after fusion.

virus, both M-tropic and T-tropic strains cocirculate. The

A dramatic conformational rearrangement of the hemag-

requirement for a new coreceptor is associated with muta-

glutinin glycoprotein (HA) of influenza virus, a virus that

tions in the surface glycoprotein of HIV. The presence of

fuses with internal membranes, has been observed by X-ray

T-tropic viruses is associated with more rapid progression to

crystallography of HA following its exposure to low pH. HA,

severe clinical disease.

which is cleaved into two disulfide-bonded fragments HA1

and HA2, forms trimers that are present in a spike on the sur-

face of the virion. The atomic structure of an HA monomer

Entry of Plant Viruses

is illustrated in Fig. 1.6. HA1 (shown in blue) is external and

Many plant viruses are important pathogens of food crops

derived from the N-terminal part of the precursor. It contains

and have been intensively studied. No specific receptors

the domain (indicated with a star in the figure) that binds to

have been identified to date, and it has been suggested that

sialic acid receptors. HA2 (shown in red) is derived from the

virus penetration of plant cells requires mechanical damage

C-terminal part of the precursor and has a C-terminal anchor

to the cell in order to allow the virus entry. Such mechanical

that spans the viral membrane. The fusion domain (yellow)

damage can be caused by farm implements or by damage

is present at the N terminus of HA2, hidden in a hydrophobic

to the plant caused by insects such as aphids or leafhoppers

pocket within the spike near the lipid bilayer of the virus enve-

that feed on the plants. Many plant viruses are transmitted

lope. Exposure to low pH results in a dramatic rearrangement

S -S

HA1 (328aa)

16aa

HA2 (221aa)

B9.

C9.

153

129

105

1(N)

153

129

1(N)

175

FIGURE 1.6 The folded structure of the influenza hemagglutinin and its rearrangement when exposed to low pH. (A) A

schematic of the cleaved HA molecule. S is the signal peptide, TM is the membrane-spanning domain. HA1 is in blue, HA2

is in red, and the fusion peptide is shown in yellow. The same color scheme is used in (B) and (C). (B) X-ray crystallographic

structure of the HA monomer. TM was removed by proteolytic digestion prior to crystallization. The receptor-binding

pocket in HA1 is shown with a green star. In the virion HA occurs as a trimeric spike. (C) The HA2 monomer in the fusion

active form. The fragment shown is produced by digesting with thermolysin, which removes most of HA1 and the fusion

peptide of HA2. Certain residues are numbered to facilitate comparison of the two forms. The approximate location of the

fusion peptide before thermolysin digestion is indicated with a yellow diamond. (B′) Diagrammatic representation of the

HA2 shown in (B), with α helices shown as cylinders and β sheets as arrows. The disulfide link between HA1 and HA2 is

shown in ochre. The domains of HA2 are color coded from N terminus to C terminus with a rainbow. (C′) Diagrammatic

representation of the fusion-active form shown in (C). Redrawn from Fields et al. (1996) p. 1361, with permission.

of HA that exposes the hydrophobic peptide and transports

rearrange to form a hexameric helical bundle, which forces

it more than 100 Å upward, where it is thought to insert into

the cellular membrane and the viral membrane together,

the cellular membrane and promote fusion. It is assumed that

resulting in fusion. Fusion can be blocked by peptides that

similar events occur for all enveloped viruses, whether fusion

bind to one or the other of the trimeric bundles, preventing

is at the cell surface or with an internal membrane.

the formation of the hexameric bundle.

Studies with HIV have further refined our understand-

For nonenveloped viruses, the mechanism by which the

ing of the fusion process. The external glycoproteins of HIV

virus breaches the cell membrane is less clear. After binding

are also synthesized as a precursor that is cleaved into an

to a receptor, somehow the virus or some subviral compo-

N-terminal protein (called gp120) and a C-terminal, mem-

nent ends up on the cytoplasmic side of a cellular membrane,

brane-spanning protein (called gp41). Like the case for influ-

the plasma membrane for some viruses, or the membrane of

enza (and many other enveloped viruses), the glycoproteins

an endosomal vesicle for others. It is believed that the inter-

form trimers. A model for the process of fusion is shown

action of the virus with a receptor, perhaps potentiated by

in Fig. 1.7. The external gp120 binds to the receptor CD4

the low pH in endosomes for those viruses that enter via the

and then to the coreceptor chemokine. The fusion domain

endosomal pathway, causes conformational rearrangements

at the N terminus of gp41 rearranges and penetrates the host

in the proteins of the virus capsid that result in the forma-

cell membrane. Two trimeric helical bundles in gp41 then

tion of a pore in the membrane. In the case of poliovirus, it

Co-receptor C

gp120

Virus interacts with

CD4

host-cell receptors

Viral membrane

Exposed

Viral prehairpin

trimeric

intermediate forms

N-peptide

gp41

Fully

exposed

C-peptide

Myc

+ 5-Helix/3Myc

+ C-peptides

Hairpin

gp41

Inhibited

Myc

intermediate

FUSION

FIGURE 1.7

A model for HIV-1 membrane fusion and two forms of inhibition. In the native state gp120 partially shields

gp41. When gp120 interacts with receptors and coreceptors on the host cell surface, gp41 undergoes a configurational

rearrangement to the transient prehairpin intermediate, in which both the N and C peptides of gp41 are exposed. Fusion

can be inhibited either by binding of C peptides to the trimeric N-peptide bundle or by binding of 5-helix/3Myc to a gp41

C peptide. Figure is adapted from Figure 6 in Koshiba and Chan (2003).

Replication and Expression of the

is known that interactions with receptors in vitro will lead

to conformational rearrangements of the virion that result

Virus Genome

in the release of one of the virion proteins, called VP4. The

The replication strategy of a virus, that is, how the

N terminus of VP4 is myristylated and thus hydrophobic

genome is organized and how it is expressed so as to lead to

[myristic acid = CH3(CH2)12COOH]. It is proposed that the

the formation of progeny virions, is an essential component

conformational changes induced by receptor binding result

in the classification of a virus. Moreover, it is necessary to

in the insertion of the myristic acid on VP4 into the cell

understand the replication strategy in order to decipher the

membrane and the formation of a channel through which

pathogenic mechanisms of a virus and, therefore, to design

the RNA can enter the cell. It is presumed that other viruses

strategies to interfere with viral disease.

also have hydrophobic domains that allow them to enter. A

number of other viruses also have a structural protein with a

DNA Viruses

myristilated N terminus that might promote entry. In some

viruses, there is thought to be a hydrophobic fusion domain

A simple schematic representation of the replication of a

in a structural protein that provides this function.

DNA virus is shown in Fig. 1.8. After binding to a receptor

The entry process may be very efficient. In the case of

and penetration of the genome into the cell, the first event in

enveloped viruses, there is evidence that at least for some

viruses the specific infectivity in cultured cells can be one

(all virions can initiate infection), and successful penetration

is thought to be efficient for all enveloped viruses. For non-

enveloped viruses, the situation varies. The specific infectiv-

ity of reoviruses assayed in cultured cells can be almost one

Uncoating

but for other viruses, entry may be less efficient. For exam-

ple, the specific infectivity of poliovirus in cultured cells is

Genome (DNA)

usually less than 1%. In general it is not known how such

specific infectivites assayed in cultured cells relate to the

infectivity of the virus when infecting host animals.

During entry of at least some viruses it is known that cel-

Transcription

lular functions must be activated and it is thought that bind-

mRNAs

ing of the virus to its receptor signals the cell to do something

that is required for virus penetration. For example, binding

Translation

of adenoviruses activates a pathway that results in polym-

Modification

erization of actin and endocytosis of the virus. As a second

DNA replication

example, internalization of the polyomavirus SV40 is regu-

lated by at least five different kinases. These activations of

Assembly

cellular pathways are only beginning to be unraveled.

Following initial penetration into the cytoplasm, further

uncoating steps must often occur. It has been suggested that,

NUCLEUS

Release

at least in some cases, translation of the genomic RNA of

plus-strand RNA viruses may promote its release from the

EUKARYOTIC HOST CELL

nucleocapsid. In other words, the ribosomes may pull the

RNA into the cytoplasm. In other cases, specific factors in

Host RNA polymerase

the host cell, or the translation products of early viral tran-

scripts, have been proposed to play a role in further uncoat-

Host DNA polymerase

ing.

Viral-encoded factor

It is interesting to note that bacteriophage face the prob-

lem of penetrating a rigid bacterial cell wall, rather than

FIGURE 1.8

General replication scheme for a DNA virus. After

one of simply penetrating a plasma membrane or intracel-

a DNA virus attaches to a cellular membrane receptor, the virus DNA

lular membrane. Many bacteriophage have evolved a tail

enters the cell and is transported to the cell nucleus. There it is transcribed

into mRNA by host RNA polymerase. Viral mRNAs are translated by

by which they attach to the cell surface, drill a hole into

host ribosomes in the cytoplasm, and newly synthesized viral proteins,

the cell, and deliver the DNA into the bacterium. In some

both structural and nonstructural, are transported back to the nucleus.

phage, the tail is contractile, leading to the analogy that the

After the DNA genome is replicated in the nucleus, either by the host

DNA is injected into the bacterium. Tailless phage are also

DNA polymerase or by a new viral-encoded polymerase, progeny virus

known that introduce their DNA into the bacterium by other

particles are assembled and ultimately released from the cell. Adapted

from Mims et al. (1993) p. 2.3.

mechamisms.

the replication of a DNA virus is the production of mRNAs

by DNA polymerase. Unit sized genomes are cut from the

from the viral DNA. For all animal DNA viruses except pox-

multilength genomes that result from this replication scheme

viruses, the infecting genome is transported to the nucleus

and are packaged into virions.

where it is transcribed by cellular RNA polymerase. The pox-

Once initiated, the progression of the replication fork is dif-

viruses replicate in the cytoplasm and do not have access to

ferent in different viruses, as illustrated in Fig. 1.9. In SV40

host cell polymerases. Therefore, in poxviruses, early mRNA

(family Polyomaviridae), for example, the genome is circular.

is transcribed from the incoming genome by a virus-encoded

An RNA primer is synthesized by primase to initiate replica-

RNA polymerase that is present in the virus core. For all ani-

tion, and the replication fork then proceeds in both directions.

mal DNA viruses, translation of early mRNA is required for

The product is two double-strand circles. In the herpesviruses,

viral DNA replication to proceed. Early gene products may

the genome is circular while it is replicating but the replication

include DNA polymerases, proteins that bind to the origin of

fork proceeds in only one direction. A linear double-strand

replication and lead to initiation of DNA replication, proteins

DNA is produced by what has been called a rolling circle.

that stimulate the cell to enter S phase and thus increase the

For this, one strand is nicked by an endonuclease and used

supply of materials required for DNA synthesis, or products

as a primer. The strand displaced by the synthesis of the new

required for further disassembly of subviral particles.

strand is made double stranded by the same mechanism used

The initiation of the replication of a viral genome is a

by the host cell for lagging strand synthesis. In adenoviruses,

specific event that requires an origin of replication, a spe-

in contrast, the genome is linear and the replication fork pro-

cific sequence element that is bound by cellular and (usu-

ceeds in only one direction. A single-strand DNA is displaced

ally) viral factors. Once initiated, DNA replication proceeds,

during the progression of the fork and coated with viral pro-

catalyzed by either a cellular or a viral DNA polymerase.

teins. It can be made double stranded by an independent syn-

The mechanisms by which replication is initiated and con-

thesis event. These different mechanisms will be described in

tinued are different for different viruses.

more detail in the discussions of the different DNA viruses in

DNA polymerases, in general, are unable to initiate a polynu-

Chapter 7.

cleotide chain. They can only extend an existing chain, following

As infection proceeds, most DNA viruses undergo a regu-

instructions from a DNA template. Replication of cellular DNA,

lar developmental cycle, in which transcription of early genes

including that of bacteria, requires the initiation of polynucleotide

is followed by the transcription of late genes. Activation of

chains by a specific RNA polymerase called DNA polymerase

the late genes may result from production of a new RNA

α-primase, or primase for short. The resulting RNA primers are

polymerase or the production of factors that change the activ-

then extended by DNA polymerase. The ribonucleotides in the

ity of existing polymerases so that a new class of promoters

primer are removed after extension of the polynucleotide chain

is recognized. The developmental cycle is, in general, more

as DNA. Removal requires the excision of the ribonucleotides by

elaborate in the larger viruses than in the smaller viruses.

a 5¢ → 3¢ exonuclease, fill-in by DNA polymerase, and sealing

of the nick by ligase. Because DNA polymerases can synthesize

Plus-Strand RNA Viruses

polynucleotide chains only in a 5¢ → 3¢ direction, and cannot ini-

tiate a DNA chain, removal of the RNA primer creates a problem

A simple schematic of the replication of a plus-strand

at the end of a linear chromosome. How is the 5¢end of a DNA

RNA virus is shown in Fig. 1.10. The virus example shown

chain to be generated? The chromosomes of eukaryotic cells have

is enveloped and gives rise to subgenomic RNAs (see later).

special sequences at the ends, called telomeres, that function in

Although the details of RNA replication and virus release are

replication to regenerate ends. The telomeres become shortened

different for other viruses, this scheme is representative of

with continued replication, and eukaryotic cells that lack telomer-

the steps required for gene expression and RNA replication.

ase to repair the telomeres can undergo only a limited number of

Following entry of the genome into the cell, the first event

replication events before they lose the ability to divide.

in replication is the translation of the incoming genomic RNA,

Viruses and bacteria have developed other mechanisms

which is a messenger, to produce proteins required for synthe-

to solve this problem. The chromosomes of bacteria are cir-

sis of antigenomic copies, also called minus strands, of the

cular, so there is no 5¢ end to deal with. Many DNA viruses

genomic RNA. Because the replication cycle begins by trans-

have adopted a similar solution. Many have circular genomes

lating the RNA genome to produce the enzymes for RNA syn-

(e.g., poxviruses, polyomaviruses, papillomaviruses). Others

thesis, the naked RNA is infectious, that is, introduction of the

have linear genomes that cyclize before or during replication

genomic RNA into a susceptible cell will result in a complete

(e.g., herpesviruses). Some DNA viruses manage to replicate

infection cycle. The antigenomic copy of the genome serves

linear genomes, however. Adenoviruses use a virus-encoded

as a template for the production of more plus-strand genomes.

protein as a primer, which remains covalently linked to the

For some plus-strand viruses, the genomic RNA is the only

5¢ end of the linear genome. The single-stranded parvovi-

mRNA produced, as illustrated schematically in Fig. 1.11A.

rus DNA genome replicates via a foldback mechanism in

It is translated into a polyprotein, a long, multifunctional pro-

which the ends of the DNA fold back and are then extended

tein that is cleaved by viral proteases, and sometimes also by

Bidirectional DNA Replication in SV40

Ori

Bidirectional

Topoisomerase

DNA synthesis

Rolling Circle DNA Replication in Herpesvirus

3 OH

Nick and continuous

Discontinuous DNA

DNA synthesis from 3 OH

synthesis, ligation

Linear DNA

Concatemer

Adenovirus DNA Replication by Displacement Synthesis

Attachment of preterminal protein

DNA-binding protein coats

Continuous synthesis in 5 to 3 direction

displaced strand

Parvovirus DNA Synthesis by Rolling Hairpin Mechanism

Inverted terminal repeats form hairpins

Elongation from 3 OH

Nick at green arrowhead

A d

a C

B A

Elongation from nick to left

Reform hairpins for primers

A d

a C

B A

Lagging strand with multiple primers

Replication complex

Leading strand with RNA primer

Preterminal protein

DPB, single-strand DNA-

binding protein

IGURE 1.9 Models for DNA replication in various virus groups. Since DNA chains cannot be initiated de novo, viruses

have used a variety of ways to prime new synthesis, such as (A) using RNA primers generated by a primase, (B) elongation

from a 3¢OH formed at a nick in a circular molecule, (C) priming by an attached protein, and (D) priming by hairpins

formed of inverted terminal repeats. Adapted from Flint et al. (2000) Figures 9.8, 9.16, 9.10, and 9.9, respectively.

Endocytosis or fusion

Genome RNA

Translation of replicase proteins

Replication

Synthesis of

subgenomic mRNA

mRNA

Translation

Capsid protein

NUCLEUS

Budding

Translation

and modification

Glycoproteins

EUKARYOTIC HOST CELL

Viral RNA synthetase

Host factor(s)

FIGURE 1.10 Replication of an enveloped, plus-strand RNA virus. After the virus attaches to a cellular receptor,

fusion of the virus envelope with the cell plasma membrane or with an endocytic vesicle releases the nucleocapsid into

the cytoplasm. The genome RNA is an mRNA, and is translated on cytoplasmic ribosomes into the proteins required

for RNA synthesis. The synthetase complex can both replicate the RNA to produce new genomes and synthesize viral

subgenomic mRNAs from a minus-strand copy of the genome. The viral structural proteins are then translated from these

subgenomic mRNAs. In the example shown, the capsid protein assembles with the genome RNA to form a capsid, while

the membrane glycoproteins are transported to the cell plasma membrane. In the final maturation step the nucleocapsid

buds out through areas of modified membrane to release the enveloped particle. Adapted from Mims et al. (1993) p. 2.3

and Strauss and Strauss (1997) Figure 2.2.

cellular proteases, to produce the final viral proteins. For other

teins encoded by the virus, one of which is an RNA polymer-

plus-strand RNA viruses, one or more subgenomic mRNAs

"e. Cellular proteins are also components of the synthetase.

are also produced from the antigenomic template (Fig.

All eukaryotic plus-strand RNA viruses replicate in the

1.11B). For these viruses, the genomic RNA is translated into

cytoplasm. There is no known nuclear involvement in their

a polyprotein required for RNA replication (i.e., the synthesis

replication. In fact, where examined, plus-strand viruses will

of the antigenomic template and synthesis of more genomic

even replicate in enucleated cells. However, it is known that

RNA) and for the synthesis of the subgenomic mRNAs. The

for many viruses, virus-encoded proteins are transported to the

subgenomic mRNAs are translated into the structural proteins

nucleus, where they may inhibit nuclear functions. For example,

required for assembly of progeny virions. Some viruses, such

a poliovirus protein cleaves transcription factors in the nucleus.

as the coronaviruses (family Coronaviridae), which produce

multiple subgenomic RNAs, also use subgenomic RNAs to

Minus-Sense and Ambisense RNA Viruses

produce nonstructural proteins that are required for the virus

replication cycle but not for RNA synthesis.

The ambisense RNA viruses and the minus-sense viruses are

The replication of the genome and synthesis of subgenomic

closely related. One family, the Bunyaviridae, even contains

RNAs require recognition of promoters in the viral RNAs by

both types of viruses as members. The ambisense strategy

the viral RNA synthetase. This synthetase contains several pro-

is, in fact, a simple modification of the minus-sense strategy,

Simple Plus-Strand RNA Virus

Template

()

Genome RNA is the

Cap or VPg

(+) only message

Genome

(mRNA)

Viral polyprotein

Complex Plus-Strand RNA Virus

(+)

Genome

One or more

(mRNA)

() subgenomic

Template

RNAs in addition to

genomic RNA

(+)

sg mRNA

Viral proteins

Minus-Strand RNA Virus

(+)

Template

() Subgenomic mRNAs

Genome

synthesized from

sg mRNA

An (+) minus strand genome

Viral proteins

Ambisense Minus-Strand RNA Virus

Viral proteins

) + (

sg mRNA

Subgenomic mRNAs

Template

transcribed from both

Genome

genome and

antigenome RNA

sg mRNA

) + (

Viral proteins

Synthesis of

Replication

Cap or VPg

Ribosome

subgenomic mRNA

FIGURE 1.11 Schematic of mRNA transcription and translation for the four major types of RNA viruses.

and these viruses are generally lumped together as "negative-

nent of an infectious virion and the naked RNA is not infec-

strand" or "minus-strand" RNA viruses (Table 1.2).

tious if delivered into a cell.

A simple schematic of the replication of a minus-sense

Multiple mRNAs are synthesized by the enzymes present

or ambisense RNA virus is shown in Fig. 1.12. All of these

in the nucleocapsid. Each mRNA is usually monocistronic

viruses are enveloped. After fusion of the virus envelope with

in the sense that it is translated into a single protein, not

a host cell membrane (some enter at the plasma membrane,

into a polyprotein (illustrated schematically in Fig. 1.11C).

some via the endosomal pathway), the virus nucleocapsid

mRNAs are released from the nucleocapsid into the cyto-

enters the cytoplasm. The nucleocapsid is helical (Chapter 2).

plasm, where they are translated. The newly synthesized

It remains intact and the viral RNA is never released from

proteins are required for the replication of the genome.

it. Because the viral genome cannot be translated, the first

Replication of the RNA requires the production of a com-

event after entry of the nucleocapsid must be the synthesis

plementary copy of the genome, as is the case for all RNA

of mRNAs. Thus, the minus-sense or ambisense strategy

viruses, but the antigenomic or vcRNA (for virion comple-

requires that the viral RNA synthetase be an integral compo-

mentary) is distinct from mRNA (Fig. 1.11C). Although

Endocytosis or fusion

mRNA synthesis

mRNAs

Replication

Translation

vcRNA

(+)

Capsid proteins

Replication

Progeny

RNA Genomes

(-)

Translation

Budding

and modification

Glycoproteins

NUCLEUS

EUKARYOTIC HOST CELL

Nucleocapsid with genome RNA(-)

Nucleocapsid with vcRNA (+)

Viral RNA synthetase

FIGURE 1.12 Replication of a typical minus-strand RNA virus. After the virus attaches to a cellular receptor, the

nucleocapsid, containing the viral RNA synthetase, is released into the cytoplasm. The viral synthetase first synthesizes

mRNAs, which are translated into the viral proteins required for synthesis of full-length complementary RNAs

(vcRNAs). These vcRNAs are the templates for minus-strand genome RNA synthesis. Throughout replication, minus-

strand genomes and plus-strand vcRNAs are present in nucleocapsids. Viral mRNAs are also translated into membrane

glycoproteins that are transported to the cell plasma membrane (or in some cases specialized internal membranes). In the

final maturation step, the nucleocapsid buds out through areas of modified membrane to release the enveloped particle.

Adapted from Strauss and Strauss (1997) Figure 2.3 on p. 77.

technically plus sense, it is not translated and is always

The effect is to delay the synthesis of mRNAs that are made

present in nucleocapsids with the associated RNA synthetic

from the antigenomic RNA and thus to introduce a timing

machinery. Replication requires ongoing protein synthesis to

mechanism into the virus life cycle.

supply protein for encapsidation of the nascent antigenomic

The mRNAs synthesized by minus-sense or ambisense

RNA during its synthesis. In the absence of such protein,

viruses differ in several key features from their templates.

the system defaults to the synthesis of mRNAs. The anti-

First, the mRNAs lack the promoters required for encap-

genomic RNA in nucleocapsids can be used as a template to

sidation or replication of the genome or antigenome. Thus,

synthesize genomic RNA if proteins for the encapsidation of

they are not encapsidated and do not serve as templates for

the nascent genomic RNA are available.

the synthesis of minus strand. Second, as befits their func-

In the ambisense viruses, the antigenomic RNA can also

tion as messengers, the mRNAs of most of these viruses are

be used as a template for mRNA (Fig. 1.11D). Thus, ambi-

capped and polyadenylated, whereas genomic and antig-

sense viruses modify the minus-sense strategy by synthe-

enomic RNAs are not. Third, the mRNAs of the viruses in the

sizing mRNA from both the genome and the antigenome.

families Orthomyxoviridae, Arenaviridae, and Bunyaviridae

have 5¢ extensions that are not present in the genome or

Neither the genome nor the antigenome serves as mRNA.

antigenome, which, where well studied, are obtained from cel-

translated by the usual cellular machinery. Thus, the reoviruses

lular mRNAs. Fourth, although most minus-strand and ambi-

share with the minus-strand RNA viruses the attribute that the

sense RNA viruses replicate in the cytoplasm, influenza virus

incoming virus genome remains associated with virus proteins

and bornavirus RNA replication occurs in the nucleus. Thus,

in a core that has the virus enzymatic machinery required to

these RNAs have access to the splicing enzymes of the host.

synthesize RNA, and the first step in replication, following

Two of the mRNAs of influenza viruses are exported in both

entry into a cell, is the synthesis of mRNAs.

an unspliced and a singly spliced version, and bornaviruses

The mRNAs also serve as intermediates in the replication

produce a number of spliced as well as unspliced mRNAs.

of the viral genome and the formation of progeny virions. After

translation, the mRNAs become associated with virus proteins.

At some point, complexes are formed that contain double-

Double-Stranded RNA Viruses

stranded forms of the mRNAs; in these complexes, the 1012

The Reoviridae, the best studied of the double-strand RNA

segments are found in equimolar amounts. These complexes can

viruses, comprise a very large family of viruses that infect ver-

mature into progeny virions. In other words, mRNAs eventually

tebrates, insects, and plants (Table 1.2). The genome consists of

form the plus strands of the double-strand genome segments.

1012 pieces of double-strand RNA. The incoming virus parti-

cle is only partially uncoated. This partial uncoating activates

Retroviruses

an enzymatic activity within the resulting subviral particle or

core that synthesizes an mRNA from each genome fragment.

An overview of the replication cycle of a retrovirus is

These mRNAs are extruded from the subviral particle and

shown in Fig. 1.13. The retroviruses are enveloped and enter

Reverse transcription

DNA copy of genome

Genomic

RNAs

Integration

into host DNA

mRNAs

Translation

RNA synthesis

Gag

Budding

Splicing

NUCLEUS

Maturation

Glycoproteins

EUKARYOTIC HOST CELL

FIGURE 1.13 Replication of a retrovirus. After entering the cell the retrovirus RNA genome is reverse transcribed into

double-stranded DNA by RT present in the virion. The DNA copy migrates to the cell nucleus and integrates into the host

genome as the "provirus." Viral mRNAs are transcribed from proviral DNA by host cell enzymes in the nucleus. Both

spliced and unspliced mRNAs are translated into viral proteins in the cytoplasm. The capsid precursor protein, "Gag,"

and RT are translated from full-length RNA. The glycoproteins are translated from spliced mRNA and transported to

the cell plasma membrane. Immature virions containing Gag, RT, and the genome RNA assemble near the modified cell

membrane. The final maturation step involves proteolytic cleavage of Gag by the viral protease and budding to produce

enveloped particles. Adapted from Fields et al. (1996) p. 1786, and Coffin et al. (1997) p. 8.

the cell by fusion, some at the plasma membrane, some at

the viral protease cleaves Gag into several components and

an internal membrane. After entry, the first event is the pro-

also separates the enzymes. Cleavage is essential for the

duction of a double-strand DNA copy of the RNA genome.

assembled virion to be infectious. Thus, current inhibitors of

This requires the activities of the enzymes RT and RNase

HIV target the protease of the virus as well as the RT, both

H, which are present in the virion. RT synthesizes DNA

of which are required for replication, but neither of which is

from either a DNA or an RNA template. RNase H degrades

present in the uninfected cell.

the RNA strand of a DNARNA hybrid and is essential for

The simple retroviruses also produce one spliced mRNA,

reverse transcription of the genome. The mechanism by

which is translated into a precursor for the envelope glycopro-

which the genome is reverse transcribed is complicated and

teins. In some retroviruses, notably the lentiviruses, of which

is described in detail in Chapter 6.

HIV is a member, differential splicing can also lead to the

The double-strand DNA copy of the genome is trans-

production of mRNAs for a number of regulatory proteins.

ported to the nucleus, where it integrates into host DNA.

Integration is essentially random within the host genome and

Hepadnaviruses

requires a recombinational event that is catalyzed by another

protein present in the virus, called integrase. The integrated

A schematic of the replication of an hepadnavirus is

DNA copy, called a provirus, is transcribed by cellular RNA

shown in Fig. 1.15. Hepadnaviruses, which are enveloped,

polymerases to produce an RNA that is identical to the viral

have a life cycle that also involves alternation of the infor-

genome. This RNA is exported to the cytoplasm either

mation in the genome between DNA and RNA. The incom-

unspliced or as one or more spliced mRNAs.

ing genome is circular, partially double-stranded DNA. The

The genomic RNA is a messenger for the translation

genome is transported to the nucleus where it is converted to

of a series of polyproteins. These polyproteins contain

a covalently closed, circular, double-strand DNA (cccDNA).

the translation products of genes called gag, pro, and pol.

Unlike the retroviruses, the DNA does not integrate into

Gag (group-specific antigen) proteins form the capsid of

the host genome but persists in the nucleus as a nonrepli-

the virus. Pro is a protease that processes the polyprotein

cating episome. It is transcribed by cellular RNA polymer-

precursors. Pol contains RT, RNase H, and integrase. The

ases, using several different promoters in the cccDNA, to

three genes are immediately adjacent in the genomic RNA,

produce a series of RNAs. These RNAs are exported to the

separated by translation stop codons whose arrangement and

cytoplasm where they serve as mRNAs. One of these RNAs,

number depend on the virus. The arrangement of stop codons

called the pregenomic (pg) RNA, is slightly longer than unit

is described in detail in Chapter 6, and the mechanisms by

length and serves as a template for reverse transcription into

which readthrough of stop codons occurs to produce longer

DNA. Reverse transcription is performed by RT and RNase

polyproteins are described later in this chapter. A simple dia-

H that are translated from the viral mRNAs. It occurs in a

gram of one retrovirus arrangement is shown in Fig. 1.14

core particle assembled from viral capsid proteins, the viral

as an example. In this example, the polyproteins translated

enzymes, and pgRNA. Reverse transcription, described in

from the genomic RNA are Gag and GagProPol. These

detail in Chapter 6, resembles that which occurs in the retro-

two polyproteins assemble with two copies of the virus

viruses, but differs in details. A complete minus-sense DNA

genome to form the capsid of the virus, usually at regions of

is first synthesized by reverse transcription. Second strand

the plasma membrane where virus glycoproteins are present.

plus-sense DNA is then initiated but only partially com-

During and immediately after virus assembly by budding,

pleted, so that the core contains partially double-stranded,

Genome RNA

(gag mRNA)

Translation

Readthrough or

(gag-pol mRNA)

frameshift

translation

gag

pro

Splicing

gag

pol

Env mRNA

Translation

env

FIGURE 1.14 Transcription and translation of the retroviral genome. Three major polyproteins (shown as colored

blocks) are produced. Gag is processed to form the nucleocapsid proteins, Pol contains RT, RNase H, and integrase, and

Env is the precursor to the membrane glycoproteins. The protease, "pro," lies between gag and pol and may be in either

the gag reading frame or the pol reading frame.

Partially ds genome DNA

Repair

RNA

pgRNA

ccc DNA

Encapsidation

mRNA

Translation

Transcription

Coat Proteins

(-)strandDNA

Glycoproteins

Partially

ds DNA

NUCLEUS

Budding into ER

EUKARYOTIC HOST CELL

Release

Host RNA Polymerase

Viral-encoded factor

FIGURE 1.15 Simplified scheme of hepadnavirus replication. In the virion, the partially ds DNA genome consists of

one full-length minus-strand DNA, and a plus-strand DNA of variable length. After the virus enters the cell, the genome

is repaired to a closed circular coiled form (cccDNA) in the nucleus. RNAs, of several sizes, including pregenomic (pg)

RNA of greater than unit length, are transcribed by host RNA polymerases. These mRNAs are exported and translated

into viral proteins in the cytoplasm. The pgRNA is encapsidated, then reverse transcribed into minus-strand DNA. The

last step before budding into the endoplasmic reticulum is the partial synthesis of (+) strand DNA. Scheme derived from

Fields et al. (1996) p. 2709.

circular DNA (i.e., the genome). The core with its DNA can

Cellular Functions Required for Replication

proceed through one of two pathways. Early in infection,

and Expression of the Viral Genome

newly assembled cores may serve to amplify the cccDNA

The relationship between a virus and its host is an intimate

present in the nucleus. These cores contain genomic DNA

one, shaped by a long history of coevolution. Viruses have

and are essentially indistinguishable from cores that enter

small genomes and cannot encode all the functions required

the cytoplasm upon infection by a virion, and their genomic

for successful replication and have borrowed many cellular

DNA can be transported to the nucleus and converted into

proteins as components of their replication machinery. The

cccDNA. Amplification of cccDNA occurs only through an

nature of the interactions between virus proteins and cellular

RNA intermediate, using the pathway just described; there

proteins is an important determinant of the host range and

is no direct replication of the DNA in the nucleus. Later in

pathology of a virus.

infection, the cores mature into virions by budding through

All animal DNA viruses, with the exception of the poxvi-

the endoplasmic reticulum. The switch to budding appears to

ruses, replicate in the nucleus. They make use of the cellular

be driven by the presence of viral envelope proteins.

machinery that exists there for the replication of their DNA

it is clear that such factors can potentially limit the host range

and the transcription of their mRNAs. Some viruses use this

of a virus. The restriction of SV40 in cells that do not make

machinery almost exclusively, whereas others, particularly

a compatible primase was cited earlier in this section. As a

the larger ones, encode their own DNA or RNA polymerases.

second example, the replication of poliovirus in a restricted

However, almost all DNA viruses encode at least a protein

set of cells in the gastrointestinal tract and its profound tro-

required for the recognition of the origin of replication in

pism for neurons if it reaches the CNS was also described

their DNA. The interplay between the viral proteins and the

earlier. These tropisms exhibited by poliovirus do not corre-

cellular proteins can affect the host range of the virus. The

late with the distribution of receptors for the virus, and are a

monkey virus SV40 (family Polyomaviridae) will replicate

result of restrictions on growth after entry of the virus. Thus

in monkey cells but not in mouse cells, whereas the closely

in addition to a requirement for a specific receptor for the

related mouse polyomavirus (also family Polyomaviridae)

virus to enter a cell, there may be a need for specific host

will replicate in mouse cells but not in monkey cells. The

factors to permit replication once a virus enters a cell. The

basis for the host restriction is an incompatibility between

permissivity of a cell for virus replication after its entry, as

the DNA polymerase α-primase of the nonpermissive host

well as the distribution of receptors for a virus, are major

and the T antigen of the restricted virus. T antigens are large

determinants of viral pathogenesis.

multifunctional proteins, one of whose functions is to bind

to the origin of replication. The T antigens of the viruses

Translation and Processing of Viral Proteins

form a preinitiation complex on the viral origin of repli-

cation, which then recruits the primase into the complex.

Viral mRNAs are translated by the cellular translation

Because the preinitiation complex containing SV40 T anti-

machinery. Most mRNAs of animal viruses are capped and

gen cannot recruit the mouse primase to form an initiation

polyadenylated. Thus, the translation pathways are the same

complex, SV40 DNA replication does not occur in mouse

as those that operate with cellular mRNAs, although many

cells. However, replication will occur in mouse cells if they

viruses interfere with the translation of host mRNAs to give

are transfected with the gene for monkey primase. Similarly,

the viral mRNAs free access to the translation machinery.

monkey primase is not recruited into the complex contain-

However, there are mechanisms of translation and process-

ing mouse polyoma virus T antigen and mouse polyoma

ing used by some viruses that have no known cellular coun-

virus does not replicate in monkey cells.

terpart. These appear to have evolved because of the special

In the case of RNA viruses, there is no preexisting cel-

problems faced by viruses and are described below.

lular machinery to replicate their RNA, and all RNA viruses

must encode at least an RNA-dependent RNA polymerase.

Cap-Independent Translation of Viral mRNAs

This RNA polymerase associates with other viral and host

A 5¢-terminal cap on an mRNA is normally required for

proteins to form an RNA replicase complex, which has the

ability to recognize promoters in the viral RNA as starting

its translation. A cellular cap-binding protein binds the cap as

points for RNA synthesis. Early studies on the RNA repli-

part of the translation initiation pathway. The mRNA is then

case of RNA phage Qβ showed that three cellular proteins

scanned by the initiation complex, starting at the cap, and

were associated with the viral RNA polymerase and were

translation begins at a downstream AUG start codon that is

required for the replication of Qβ RNA. These three pro-

present in a favorable context. However, some viruses, such

teins, ribosomal protein S1 and two translation elongation

as poliovirus and other members of the Picornaviridae and

factors EF-Ts and EF-Tu, all function in protein synthesis in

hepatitis C virus (genus Hepacivirus, family Flaviviridae),

the cell. The virus appropriates these three proteins in order

have uncapped mRNAs and use another mechanism for

the initiation of translation. The 5¢ nontranslated regions

to assemble an active replicase complex. Recent studies on

animal and plant RNA viruses have shown that a variety of

(NTRs) of the RNAs of two picornaviruses, poliovirus and

cellular proteins also appear to be required for their tran-

encephalomyelitis virus (EMCV), are illustrated schemati-

cally in Fig. 1.16. These 5¢ NTRs are long--more than 700

scription and replication. One interesting finding is that the

nucleotides. Within this 5¢ region is a sequence of about 400

animal equivalents of EF-Ts and EF-Tu are required for the

activity of the replicase of vesicular stomatitis virus. This

nucleotides called an IRES (internal ribosome entry site).

suggests that the association of these two translation factors

Ribosomes bind to the IRES and initiate translation in a cap-

with viral RNA replicases is ancient. Several other cellular

independent fashion. It is known that the secondary structure

proteins have also been found to be associated with viral

of the IRES is critical for its function and that the position

RNA polymerases or with viral RNA during replication, but

of the initiating AUG with respect to the IRES is important.

evidence for their functional role is incomplete.

Interestingly, IRES elements may have entirely different

Although our knowledge of the nature of host factors

sequences in different viruses and, hence, different apparent

involved in the replication of viral genomes and the interplay

higher order structures. Comparison of the IRES elements of

between virus-encoded and host cell proteins is incomplete,

poliovirus and EMCV in Fig. 1.16 illustrates the differences

560

EMCV (Type II) IRES

nitiating

AUG codon

620

nt 834

300

360

460

100

800

260 2

120

700

420

VPg

PV (Type I) IRES

Poly (C)

Pyrimidine-rich tract

388

Spacer (15-20 nts)

AUG

AUG codon

IRES

III

Initiating

462

AUG codon

nt 743

547

110

620

AUG 3

162

220

123 nt

FIGURE 1.16 Schematic diagram of the secondary structures in the 5¢-nontranslated regions of encephalomyelocarditis

virus (EMCV) and poliovirus (PV). The internal ribosome entry sites, or IRES elements, are shaded. There is an element

at the 3¢ border of the IRES consisting of a pyrimidine-rich tract (box with diagonal hatching), a spacer (magenta line)

(usually 1520 nucleotides) and an AUG codon. In the Type II IRES this AUG is the initiating codon, but in a Type I IRES

a second codon, in this case 123 nucleotides further down, is used for initiation. Adapted from Wimmer et al. (1993)

p. 374 with permission.

in apparent structure. Yet they promote internal initiation in

of a 3¢ gene. Since it is possible to construct polycistronic

a similar fashion, and the IRES elements of poliovirus and

mRNAs using IRES elements, it is somewhat puzzling that

EMCV can be exchanged to yield a viable virus.

animal viruses have never used them to do so.

The IRES elements of viruses are always found within

Using an IRES allows a virus to preferentially translate

the 5¢ NTR. However, if an IRES is placed in the middle of

viral mRNAs. Thus, for example, poliovirus blocks cap-

an mRNA, it will function to initiate translation. True poly-

dependent translation after infection by cleaving the cellular

cistronic mRNAs have been constructed by placing multiple

cap-binding protein. By blocking cap-dependent translation,

IRES elements into mRNAs, or by combining cap-dependent

most host mRNAs cannot be translated (although IRESs

translation of a 5¢ gene with an IRES-dependent translation

are known to exist in some eukaryotic mRNAs), whereas

viral mRNAs are not affected. This reserves the translation

shows the -1 frameshifting that occurs between the gag

machinery for translation of viral mRNAs and also blocks

and pol genes of avian leukosis virus (ALV). Frameshifting

many host defense mechanisms (Chapter 10).

occurs at a precise sequence known as a "slippery" sequence,

shown in green. Slippery sequences have short strings of the

same nucleotide and are often rich in A and U. For ALV,

Ribosomal Frameshifting

termination at the UAG indicated with the asterisk produces

Retroviruses, many plus-strand RNA viruses, and certain

a polyprotein that contains the sequences for Gag and Pro.

other viruses expand the range of polyproteins produced by

Frameshifting results in movement into the -1 frame at this

having long open reading frames (ORFs) interrupted by stop

point so that the codon following UUA (leucine) becomes

codons. Termination of the polyprotein at the stop codon

AUA (isoleucine) rather than UAG (stop), and transla-

leads to production of a truncated polyprotein having cer-

tion of the downstream gene (pol) follows to produce the

tain functions, whereas readthrough leads to the production

polyprotein GagProPol.

of a longer polyprotein with additional functions. This was

Frameshifting usually requires a structural feature, such

illustrated in Fig. 1.14 for a retrovirus. Two mechanisms

as a hairpin, downstream of the slippery sequence in order

are used by different viruses to ignore the stop codon. The

to slow the ribosome at this point and allow more time for

first is simply to read the stop codon as sense. In this case

the frameshifting to take place. The structure that is required

the downstream sequences are in the same reading frame as

for frameshifting in a yeast RNA virus called L-A is shown

the upstream sequences. The mechanism of readthrough is

in Fig. 1.18. The sizable hairpin just downstream of the slip-

thought to involve wobble in the third codon position that

pery sequence is further stabilized by a pseudoknot. In this

allows a tRNA to bind to and insert an amino acid at the

case the slippery sequence, in which frameshifting takes

stop codon position. Both amber (UAG) and opal (UGA)

place, occurs about 110 nucleotides upstream of the stop

codons have been found in different readthrough posi-

codon for the upstream reading frame (Gag protein reading

tions. Readthrough efficiency is variable, although usually

frame). Thus, these 110 nucleotides are translated in two dif-

between 5 and 20%.

ferent reading frames: the Gag reading frame if frameshift-

The second mechansim for ignoring the stop codon

ing does not occur, or the Pol reading frame if frameshifting

is ribosomal frameshifting in which the reading frame is

does occur. The sequence illustrated in Fig. 1.18 is the mini-

shifted into the plus 1 or minus 1 frame upstream of the stop

mum sequence required for frameshifting. It can be placed

codon. In this case, the downstream sequences are in a dif-

in the middle of an unrelated mRNA and 1 frameshifting

ferent reading frame from the upstream sequences. Fig. 1.17

will occur.

Ribosomal Frameshift in Avian Leukosis Virus

Protease

N L3 *

RNA sequence

UUGACAAAUUUAUAGGGAGGGCC

Polymerase

Pro-Pol fusion protein

L I

Mechanism of the (-1) Frameshift

Ribosome

UAU

Peptide

Stop

AAU

UAU

AAU

XA AAU

UUA UAG GGXXXX

AAA

UUU

AUA GGG XXXX

t-RNA slips on message as

mRNA shifts one position to

the right

FIGURE 1.17

Proposed mechanism of the (-1) ribosomal frameshift that occurs in ALV (avian leukosis virus). The

slippery sequence is shown in green. The asterisk identifies the UAG codon that terminates the upstream (GagPro)

ORF. Frameshifting is thought to require a pseudoknot downstream of the "slippery sequence" (illustrated in Fig. 1.18).

Adapted from Fields et al. (1996) p. 577 and Goff (1997) Figure 3.15 on p. 156.

teases, of which chymotrypsin is a well-studied example,

. nt 2025

Stem 2

have a catalytic triad composed of histidine, aspartic acid,

G U C GC

A C

and serine, which form the active site of the enzyme. Where

Pseudoknot

structures have been determined, the viral proteases possess a

C G

nt 1983

fold related to that of chymotrypsin and possess an active site

with geometry identical to that of chymotrypsin. The structure

of protease 3Cpro of a rhinovirus (family Picornaviridae) is

shown in Fig. 1.19A as an example (another example is shown

Stem 1 U

in Chapter 2, Fig. 2.14B). Although most viral serine-type

proteases have a catalytic triad composed of histidine, aspar-

tic acid, and serine, the rhinovirus protease has an active site

nt 1951

Slippery site

composed of histidine, glutamic acid, which replaces aspartic

G G

...CUCAGCAGGGUUUAGGAG

nt 2005

acid, and cysteine, which replaces serine. The replacement of

Gag ORF

the active site serine by cysteine causes problems with nomen-

Pol ORF

clature. Here we use serine protease (or serine-type protease)

FIGURE 1.18 The site in L-A RNA that promotes 1 ribosomal

to refer to a protease whose structure and active site geometry

frameshifting to form the GagPol fusion protein. The pseudoknot makes

are related to those of the animal serine proteases, rather than

the ribosome pause over the slippery site (nt 19581964 shown in green).

as a description of the catalytic amino acid. These similari-

The gag and pol ORFs overlap for 130 nucleotides and in the absence of

ties in structure make it likely that the viruses acquired the

frameshifting the Gag protein terminates at nt 2072. Adapted from Fields

et al. (1996) p. 566.

protease from a host and modeled it to fit their own needs.

A second group of proteases is related to the papain-like

The efficiency of frameshifting is variable and depends

enzymes of plants and animals. These proteases have a cata-

on the frameshifting sequences. Thus, the efficiency of

lytic dyad consisting of histidine and cysteine. A third residue

frameshifting can be modulated by mutations in the virus.

is sometimes considered a part of the active site (as described

For example, the frameshifting sequence in Fig. 1.18 results

later) and the active site is then referred to as a catalytic triad.

in frameshifting about 2% of the time. Changing the slip-

Model folding studies have suggested that these viral papain-

pery sequence from GGGUUU to UUUUUU results in

like proteases are related to the cellular counterparts. Such

frameshifting 12% of the time. Frameshifting efficiencies of

proteases are found in many plus-strand RNA viruses and

from 2% to more than 20% have been observed at different

in adenoviruses. The structure of the adenovirus papain-like

frameshift sites in different viruses.

protease is shown in Fig. 1.19B. Notice that the structure of this

enzyme is very different from the serine-type protease of rhino-

viruses in Fig. 1.19A, even though the active site is composed

Processing of Viral Polyproteins

of the same three residues, Cys, His, and Glu. In addition, the

Many viruses produce polyproteins, as described earlier

sequence of the active site residues in the linear amino acid

in this chapter. These polyproteins are cleaved into individ-

sequence of serine-type proteases is His, Glu, Cys, whereas the

ual proteins by viral enzymes, with the exception of precur-

order is Cys, His, Glu in the adenovirus protease and in papain

sors to viral envelope proteins, which have access to cellular

(where the active site contains Asn rather than Glu).

enzymes present in subcellular compartments. The use of

The retroviruses encode a protease to process the Gag

viral enzymes to process polyproteins may be due in part to a

and GagPol polyproteins during virus maturation. The pro-

lack of appropriate proteases in the cytoplasm of eukaryotes.

tease is related to the aspartate proteases of animals, which

However, the use of a viral protease also allows the virus to

include pepsin, renin, and cathepsin D. The structure of

fine-tune the processing events, and this control is often used

the HIV protease is shown in Fig. 1.19C. The active site of

to regulate the viral replication cycle.

aspartate proteases consists of two aspartate residues. In the

The viral proteases are components of the translated poly-

animal enzymes, the two aspartate residues are present in

proteins. Some cleavages catalyzed by these proteases can

a single polypeptide chain that folds to bring the aspartate

occur in cis, in a monomolecular reaction in which the poly-

residues together to form the active site. In HIV, the active

protein cleaves itself. Other cleavages occur in trans, whereby

site is formed by dimerization of two Pro protein monomers

a polyprotein, or a cleaved product containing the protease,

of about 100 residues, each of which contributes one of the

cleaves another polyprotein in a bimolecular reaction. In many

aspartate residues to the active site.

cases the series of cleavages effected by a protease proceeds in

a defined manner and serves to regulate the virus life cycle.

Assembly of Progeny Virions

Three types of virus proteases have been found in different

viruses. Proteases related to the serine proteases of animals

The last stage in the virus life cycle is the assembly of

are common in animal RNA viruses. The animal serine pro-

progeny virions and their release from the infected cell. The

Search WWH :

Custom Search

Viruses And Human Disease Topic Index

Viruses And Human Disease Bookmarks

Home